Incidental Mutation 'R7120:Orai1'
ID551922
Institutional Source Beutler Lab
Gene Symbol Orai1
Ensembl Gene ENSMUSG00000049686
Gene NameORAI calcium release-activated calcium modulator 1
SynonymsD730049H07Rik, Tmem142a
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7120 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location123015074-123030456 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123029472 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 236 (E236G)
Ref Sequence ENSEMBL: ENSMUSP00000058169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051016] [ENSMUST00000121652]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051016
AA Change: E236G

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000058169
Gene: ENSMUSG00000049686
AA Change: E236G

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 19 41 N/A INTRINSIC
low complexity region 43 50 N/A INTRINSIC
Pfam:Orai-1 69 273 3.4e-84 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000121652
AA Change: E236G

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113097
Gene: ENSMUSG00000049686
AA Change: E236G

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 19 41 N/A INTRINSIC
low complexity region 43 50 N/A INTRINSIC
Pfam:Orai-1 73 270 5e-74 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane calcium channel subunit that is activated by the calcium sensor STIM1 when calcium stores are depleted. This type of channel is the primary way for calcium influx into T-cells. Defects in this gene are a cause of immune dysfunction with T-cell inactivation due to calcium entry defect type 1 (IDTICED1). [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit small body size and defective mast cell degranulation, cytokine secretion and passive anaphalaxis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik A T 3: 36,481,867 Q94L unknown Het
4933411K16Rik C T 19: 42,052,673 A81V probably benign Het
Actr3 A C 1: 125,403,432 Y273* probably null Het
Aoc1 T A 6: 48,906,597 I469N probably damaging Het
Arhgef28 A T 13: 97,944,539 L1270Q probably damaging Het
Atp2c1 G A 9: 105,420,186 Q780* probably null Het
Bbs10 T C 10: 111,299,449 V141A possibly damaging Het
Bivm A T 1: 44,126,446 T19S probably benign Het
Cacna1h T G 17: 25,391,507 H675P probably benign Het
Cadps T A 14: 12,439,919 L1204F probably damaging Het
Cald1 T C 6: 34,686,076 probably null Het
Calr A G 8: 84,842,828 M357T probably damaging Het
Ccni A T 5: 93,183,331 Y260* probably null Het
Csrnp3 C A 2: 66,023,010 T594K probably damaging Het
Dek A T 13: 47,100,183 M152K unknown Het
Depdc1b T C 13: 108,362,247 W155R probably benign Het
Ehd1 A G 19: 6,297,561 K315R probably benign Het
Epn3 C A 11: 94,492,428 R323S probably benign Het
Fam57b T C 7: 126,829,333 L221P probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbxo10 T A 4: 45,040,533 K891* probably null Het
Fras1 G T 5: 96,752,960 G3013* probably null Het
Gbp2b A G 3: 142,606,746 T297A probably benign Het
Gbp7 T C 3: 142,543,973 S402P probably damaging Het
Gclc T C 9: 77,786,750 Y329H probably damaging Het
Gfpt1 A G 6: 87,087,393 H655R probably benign Het
Gm4787 C A 12: 81,378,486 M299I probably benign Het
Grb7 C A 11: 98,454,991 R532S probably benign Het
Hmcn1 A T 1: 150,700,541 I2066N probably damaging Het
Hnrnpll T C 17: 80,034,057 T518A probably benign Het
Hps3 G A 3: 20,011,541 R712W probably damaging Het
Hspd1 A G 1: 55,079,229 V406A probably benign Het
Igkv2-112 T C 6: 68,220,526 F61L probably benign Het
Iqcf5 G A 9: 106,515,796 R84H probably damaging Het
Itgad T A 7: 128,173,974 M1K probably null Het
Kmt2d A G 15: 98,861,065 S1292P unknown Het
Macc1 C A 12: 119,445,745 Q83K possibly damaging Het
Map3k4 G T 17: 12,271,467 A359E probably damaging Het
Mfap3 T A 11: 57,528,217 C68S probably damaging Het
Mipep C T 14: 60,875,247 R660C possibly damaging Het
Morc2b A T 17: 33,135,813 L995Q probably damaging Het
Mrc1 A G 2: 14,308,697 N913S probably damaging Het
N4bp1 C A 8: 86,860,867 C481F probably benign Het
Nae1 A G 8: 104,526,278 probably null Het
Nup214 T A 2: 32,051,042 V29E probably benign Het
Olfr251 T C 9: 38,378,649 L250P probably damaging Het
Olfr390 A T 11: 73,787,114 M59L probably damaging Het
P2rx7 A G 5: 122,681,294 Y593C probably benign Het
Pcbp2 A G 15: 102,474,678 D77G possibly damaging Het
Pcdha8 G A 18: 36,993,787 V441M possibly damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Plaa A G 4: 94,582,682 S406P possibly damaging Het
Plekhh1 C A 12: 79,070,939 P903Q probably benign Het
Plekhh3 T C 11: 101,168,238 E92G probably damaging Het
Ptpn9 T C 9: 57,059,882 F463S probably damaging Het
Ptprn2 A C 12: 116,872,056 E337A probably benign Het
Rubcn C T 16: 32,836,469 R527Q probably damaging Het
Samd3 C T 10: 26,230,966 T73M possibly damaging Het
Sfxn4 T A 19: 60,852,039 K173* probably null Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Son T G 16: 91,670,526 N2258K unknown Het
Sspo A T 6: 48,465,571 H2000L probably benign Het
Syne1 C T 10: 5,293,971 S2731N probably benign Het
Syt6 T C 3: 103,587,357 Y213H probably damaging Het
Tkt A G 14: 30,559,822 N99S probably benign Het
Tmem258 G A 19: 10,204,238 probably benign Het
Tnks1bp1 T C 2: 85,072,097 S1702P probably damaging Het
Tpte A G 8: 22,327,673 D225G probably damaging Het
Trak1 T A 9: 121,460,498 F625L probably benign Het
Ttc33 G T 15: 5,212,007 C77F probably benign Het
Ugt1a2 A G 1: 88,200,800 H55R probably damaging Het
Vmn1r169 G T 7: 23,578,019 V279L probably benign Het
Vmn2r25 T C 6: 123,828,435 K488E possibly damaging Het
Vmn2r8 A T 5: 108,808,638 D39E possibly damaging Het
Other mutations in Orai1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1623:Orai1 UTSW 5 123029202 missense probably damaging 1.00
R4879:Orai1 UTSW 5 123011831 unclassified probably benign
R4952:Orai1 UTSW 5 123029250 missense probably damaging 1.00
R5389:Orai1 UTSW 5 123029501 missense probably benign 0.37
R7673:Orai1 UTSW 5 123029442 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTCGGTCAAAGAGTCACCC -3'
(R):5'- TTAGAGAATGGTCCCCTCTGTG -3'

Sequencing Primer
(F):5'- TGCATCGCCACATCGAG -3'
(R):5'- CTCTGTGGTCCAGCTGGTC -3'
Posted On2019-05-15