Incidental Mutation 'R7120:Peg10'
ID551923
Institutional Source Beutler Lab
Gene Symbol Peg10
Ensembl Gene ENSMUSG00000092035
Gene Namepaternally expressed 10
SynonymsHB-1, MyEF-3, Mart2, Mar2, MyEF-3 like, MEF3L, Edr
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7120 (G1)
Quality Score207.468
Status Not validated
Chromosome6
Chromosomal Location4747306-4760517 bp(+) (GRCm38)
Type of Mutationsmall deletion (18 aa in frame mutation)
DNA Base Change (assembly) CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG at 4756398 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166678] [ENSMUST00000176204] [ENSMUST00000176551]
Predicted Effect probably benign
Transcript: ENSMUST00000166678
SMART Domains Protein: ENSMUSP00000127306
Gene: ENSMUSG00000092035

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 34 50 N/A INTRINSIC
low complexity region 80 107 N/A INTRINSIC
Pfam:DUF4939 130 220 6.1e-17 PFAM
Pfam:Retrotrans_gag 174 267 2.9e-20 PFAM
low complexity region 334 342 N/A INTRINSIC
ZnF_C2HC 345 361 3.34e-2 SMART
low complexity region 368 379 N/A INTRINSIC
low complexity region 541 610 N/A INTRINSIC
low complexity region 621 660 N/A INTRINSIC
low complexity region 663 785 N/A INTRINSIC
Blast:SERPIN 798 910 1e-5 BLAST
low complexity region 923 936 N/A INTRINSIC
low complexity region 972 998 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176204
SMART Domains Protein: ENSMUSP00000134963
Gene: ENSMUSG00000092035

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 34 50 N/A INTRINSIC
low complexity region 80 107 N/A INTRINSIC
Pfam:Retrotrans_gag 174 267 1.3e-20 PFAM
low complexity region 334 342 N/A INTRINSIC
ZnF_C2HC 345 361 3.34e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176551
SMART Domains Protein: ENSMUSP00000135076
Gene: ENSMUSG00000092035

DomainStartEndE-ValueType
low complexity region 173 242 N/A INTRINSIC
low complexity region 253 292 N/A INTRINSIC
low complexity region 295 417 N/A INTRINSIC
Blast:SERPIN 430 542 6e-6 BLAST
low complexity region 555 568 N/A INTRINSIC
low complexity region 604 630 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: This is a paternally expressed imprinted gene that is thought to have been derived from the Ty3/Gypsy family of retrotransposons. It contains two overlapping open reading frames, RF1 and RF2, and expresses two proteins: a shorter, gag-like protein (with a CCHC-type zinc finger domain) from RF1; and a longer, gag/pol-like fusion protein (with an additional aspartic protease motif) from RF1/RF2 by -1 translational frameshifting (-1 FS). While -1 FS has been observed in RNA viruses and transposons in both prokaryotes and eukaryotes, this gene represents the first example of -1 FS in a eukaryotic cellular gene. This gene is highly conserved across mammalian species and retains the heptanucleotide (GGGAAAC) and pseudoknot elements required for -1 FS. It is expressed in adult and embryonic tissues (most notably in placenta) and reported to have a role in cell proliferation, differentiation, apoptosis and cancer development. Knockout mice lacking this gene showed early embryonic lethality with placental defects, indicating the importance of this gene in embryonic development. [provided by RefSeq, Oct 2014]
PHENOTYPE: Heterozygous mice with a paternally inherited null allele display embryonic lethality during organogenesis with abnormal placental development. Heterozygous mice with a maternally inherited null allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik A T 3: 36,481,867 Q94L unknown Het
4933411K16Rik C T 19: 42,052,673 A81V probably benign Het
Actr3 A C 1: 125,403,432 Y273* probably null Het
Aoc1 T A 6: 48,906,597 I469N probably damaging Het
Arhgef28 A T 13: 97,944,539 L1270Q probably damaging Het
Atp2c1 G A 9: 105,420,186 Q780* probably null Het
Bbs10 T C 10: 111,299,449 V141A possibly damaging Het
Bivm A T 1: 44,126,446 T19S probably benign Het
Cacna1h T G 17: 25,391,507 H675P probably benign Het
Cadps T A 14: 12,439,919 L1204F probably damaging Het
Cald1 T C 6: 34,686,076 probably null Het
Calr A G 8: 84,842,828 M357T probably damaging Het
Ccni A T 5: 93,183,331 Y260* probably null Het
Csrnp3 C A 2: 66,023,010 T594K probably damaging Het
Dek A T 13: 47,100,183 M152K unknown Het
Depdc1b T C 13: 108,362,247 W155R probably benign Het
Ehd1 A G 19: 6,297,561 K315R probably benign Het
Epn3 C A 11: 94,492,428 R323S probably benign Het
Fam57b T C 7: 126,829,333 L221P probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbxo10 T A 4: 45,040,533 K891* probably null Het
Fras1 G T 5: 96,752,960 G3013* probably null Het
Gbp2b A G 3: 142,606,746 T297A probably benign Het
Gbp7 T C 3: 142,543,973 S402P probably damaging Het
Gclc T C 9: 77,786,750 Y329H probably damaging Het
Gfpt1 A G 6: 87,087,393 H655R probably benign Het
Gm4787 C A 12: 81,378,486 M299I probably benign Het
Grb7 C A 11: 98,454,991 R532S probably benign Het
Hmcn1 A T 1: 150,700,541 I2066N probably damaging Het
Hnrnpll T C 17: 80,034,057 T518A probably benign Het
Hps3 G A 3: 20,011,541 R712W probably damaging Het
Hspd1 A G 1: 55,079,229 V406A probably benign Het
Igkv2-112 T C 6: 68,220,526 F61L probably benign Het
Iqcf5 G A 9: 106,515,796 R84H probably damaging Het
Itgad T A 7: 128,173,974 M1K probably null Het
Kmt2d A G 15: 98,861,065 S1292P unknown Het
Macc1 C A 12: 119,445,745 Q83K possibly damaging Het
Map3k4 G T 17: 12,271,467 A359E probably damaging Het
Mfap3 T A 11: 57,528,217 C68S probably damaging Het
Mipep C T 14: 60,875,247 R660C possibly damaging Het
Morc2b A T 17: 33,135,813 L995Q probably damaging Het
Mrc1 A G 2: 14,308,697 N913S probably damaging Het
N4bp1 C A 8: 86,860,867 C481F probably benign Het
Nae1 A G 8: 104,526,278 probably null Het
Nup214 T A 2: 32,051,042 V29E probably benign Het
Olfr251 T C 9: 38,378,649 L250P probably damaging Het
Olfr390 A T 11: 73,787,114 M59L probably damaging Het
Orai1 A G 5: 123,029,472 E236G possibly damaging Het
P2rx7 A G 5: 122,681,294 Y593C probably benign Het
Pcbp2 A G 15: 102,474,678 D77G possibly damaging Het
Pcdha8 G A 18: 36,993,787 V441M possibly damaging Het
Plaa A G 4: 94,582,682 S406P possibly damaging Het
Plekhh1 C A 12: 79,070,939 P903Q probably benign Het
Plekhh3 T C 11: 101,168,238 E92G probably damaging Het
Ptpn9 T C 9: 57,059,882 F463S probably damaging Het
Ptprn2 A C 12: 116,872,056 E337A probably benign Het
Rubcn C T 16: 32,836,469 R527Q probably damaging Het
Samd3 C T 10: 26,230,966 T73M possibly damaging Het
Sfxn4 T A 19: 60,852,039 K173* probably null Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Son T G 16: 91,670,526 N2258K unknown Het
Sspo A T 6: 48,465,571 H2000L probably benign Het
Syne1 C T 10: 5,293,971 S2731N probably benign Het
Syt6 T C 3: 103,587,357 Y213H probably damaging Het
Tkt A G 14: 30,559,822 N99S probably benign Het
Tmem258 G A 19: 10,204,238 probably benign Het
Tnks1bp1 T C 2: 85,072,097 S1702P probably damaging Het
Tpte A G 8: 22,327,673 D225G probably damaging Het
Trak1 T A 9: 121,460,498 F625L probably benign Het
Ttc33 G T 15: 5,212,007 C77F probably benign Het
Ugt1a2 A G 1: 88,200,800 H55R probably damaging Het
Vmn1r169 G T 7: 23,578,019 V279L probably benign Het
Vmn2r25 T C 6: 123,828,435 K488E possibly damaging Het
Vmn2r8 A T 5: 108,808,638 D39E possibly damaging Het
Other mutations in Peg10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02029:Peg10 APN 6 4754473 utr 5 prime probably benign
IGL03063:Peg10 APN 6 4756647 utr 3 prime probably benign
piaggio UTSW 6 4756427 utr 3 prime probably benign
PIT4480001:Peg10 UTSW 6 4756560 missense unknown
R0090:Peg10 UTSW 6 4756063 utr 3 prime probably benign
R0148:Peg10 UTSW 6 4755711 missense possibly damaging 0.88
R0650:Peg10 UTSW 6 4756475 small insertion probably benign
R0698:Peg10 UTSW 6 4756835 utr 3 prime probably benign
R1600:Peg10 UTSW 6 4757080 utr 3 prime probably benign
R1842:Peg10 UTSW 6 4756381 utr 3 prime probably benign
R1930:Peg10 UTSW 6 4755778 missense probably damaging 0.99
R1931:Peg10 UTSW 6 4755778 missense probably damaging 0.99
R2162:Peg10 UTSW 6 4755914 utr 3 prime probably benign
R2215:Peg10 UTSW 6 4756918 utr 3 prime probably benign
R2339:Peg10 UTSW 6 4756102 utr 3 prime probably benign
R2847:Peg10 UTSW 6 4756912 utr 3 prime probably benign
R2848:Peg10 UTSW 6 4756912 utr 3 prime probably benign
R3000:Peg10 UTSW 6 4754276 utr 5 prime probably benign
R3056:Peg10 UTSW 6 4755029 missense possibly damaging 0.66
R4051:Peg10 UTSW 6 4754534 missense probably benign 0.00
R4059:Peg10 UTSW 6 4756427 utr 3 prime probably benign
R4296:Peg10 UTSW 6 4756472 small insertion probably benign
R4626:Peg10 UTSW 6 4756460 small insertion probably benign
R4634:Peg10 UTSW 6 4756452 small insertion probably benign
R4679:Peg10 UTSW 6 4756452 small insertion probably benign
R4834:Peg10 UTSW 6 4754294 utr 5 prime probably benign
R4982:Peg10 UTSW 6 4756451 small insertion probably benign
R4983:Peg10 UTSW 6 4756451 small insertion probably benign
R4996:Peg10 UTSW 6 4756454 small insertion probably benign
R4997:Peg10 UTSW 6 4756457 small insertion probably benign
R5015:Peg10 UTSW 6 4756453 small insertion probably benign
R5085:Peg10 UTSW 6 4755864 utr 3 prime probably benign
R5091:Peg10 UTSW 6 4754511 missense probably benign 0.01
R5231:Peg10 UTSW 6 4756939 utr 3 prime probably benign
R5278:Peg10 UTSW 6 4756442 small deletion probably benign
R5364:Peg10 UTSW 6 4756128 utr 3 prime probably benign
R5397:Peg10 UTSW 6 4756453 small insertion probably benign
R5485:Peg10 UTSW 6 4755565 missense probably benign 0.09
R5573:Peg10 UTSW 6 4755913 utr 3 prime probably benign
R5710:Peg10 UTSW 6 4756350 small insertion probably benign
R5710:Peg10 UTSW 6 4756351 small insertion probably benign
R5736:Peg10 UTSW 6 4754423 missense probably benign 0.00
R5865:Peg10 UTSW 6 4754375 missense probably damaging 0.98
R6056:Peg10 UTSW 6 4756449 small insertion probably benign
R6116:Peg10 UTSW 6 4756351 small insertion probably benign
R6129:Peg10 UTSW 6 4756449 small insertion probably benign
R6147:Peg10 UTSW 6 4754499 start gained probably benign
R6171:Peg10 UTSW 6 4756449 small insertion probably benign
R6194:Peg10 UTSW 6 4756351 small insertion probably benign
R6197:Peg10 UTSW 6 4756452 small insertion probably benign
R6207:Peg10 UTSW 6 4756449 small insertion probably benign
R6215:Peg10 UTSW 6 4756452 small insertion probably benign
R6276:Peg10 UTSW 6 4756449 small insertion probably benign
R6281:Peg10 UTSW 6 4756449 small insertion probably benign
R6287:Peg10 UTSW 6 4756451 small insertion probably benign
R6302:Peg10 UTSW 6 4756449 small insertion probably benign
R6393:Peg10 UTSW 6 4756452 small insertion probably benign
R6394:Peg10 UTSW 6 4756451 small insertion probably benign
R6405:Peg10 UTSW 6 4756453 small insertion probably benign
R6421:Peg10 UTSW 6 4756449 small insertion probably benign
R6486:Peg10 UTSW 6 4756449 small insertion probably benign
R6538:Peg10 UTSW 6 4756449 small insertion probably benign
R6668:Peg10 UTSW 6 4754502 missense probably benign 0.01
R6679:Peg10 UTSW 6 4754276 utr 5 prime probably benign
R6685:Peg10 UTSW 6 4754738 missense probably damaging 1.00
R6702:Peg10 UTSW 6 4756452 small insertion probably benign
R6706:Peg10 UTSW 6 4756452 small insertion probably benign
R6747:Peg10 UTSW 6 4757137 utr 3 prime probably benign
R6775:Peg10 UTSW 6 4756452 small insertion probably benign
R6811:Peg10 UTSW 6 4756451 small insertion probably benign
R6823:Peg10 UTSW 6 4756431 small deletion probably benign
R6826:Peg10 UTSW 6 4756353 small insertion probably benign
R6847:Peg10 UTSW 6 4754279 utr 5 prime probably benign
R6861:Peg10 UTSW 6 4756350 small insertion probably benign
R6861:Peg10 UTSW 6 4756351 small insertion probably benign
R6876:Peg10 UTSW 6 4756451 small insertion probably benign
R6891:Peg10 UTSW 6 4756449 small insertion probably benign
R6911:Peg10 UTSW 6 4756452 small insertion probably benign
R6973:Peg10 UTSW 6 4756431 small deletion probably benign
R6990:Peg10 UTSW 6 4756451 small insertion probably benign
R6998:Peg10 UTSW 6 4756398 small deletion probably benign
R7070:Peg10 UTSW 6 4756454 small insertion probably benign
R7132:Peg10 UTSW 6 4756398 small deletion probably benign
R7140:Peg10 UTSW 6 4756452 small insertion probably benign
R7189:Peg10 UTSW 6 4756431 small deletion probably benign
R7208:Peg10 UTSW 6 4756398 small deletion probably benign
R7256:Peg10 UTSW 6 4756398 small deletion probably benign
R7260:Peg10 UTSW 6 4756398 small deletion probably benign
R7261:Peg10 UTSW 6 4756591 missense unknown
R7401:Peg10 UTSW 6 4756452 small insertion probably benign
R7409:Peg10 UTSW 6 4756398 small deletion probably benign
R7439:Peg10 UTSW 6 4756453 small insertion probably benign
R7466:Peg10 UTSW 6 4756453 small insertion probably benign
R7475:Peg10 UTSW 6 4756398 small deletion probably benign
R7483:Peg10 UTSW 6 4756451 small insertion probably benign
R7502:Peg10 UTSW 6 4756398 small deletion probably benign
R7515:Peg10 UTSW 6 4756452 small insertion probably benign
R7520:Peg10 UTSW 6 4756796 missense unknown
R7544:Peg10 UTSW 6 4756427 frame shift probably null
R7571:Peg10 UTSW 6 4756082 missense unknown
R7581:Peg10 UTSW 6 4756452 small insertion probably benign
R7616:Peg10 UTSW 6 4756449 small insertion probably benign
R7620:Peg10 UTSW 6 4756449 small insertion probably benign
R7623:Peg10 UTSW 6 4756449 small insertion probably benign
R7635:Peg10 UTSW 6 4754938 missense probably damaging 0.99
R7677:Peg10 UTSW 6 4756398 small deletion probably benign
R7697:Peg10 UTSW 6 4756453 small insertion probably benign
R7710:Peg10 UTSW 6 4756452 small insertion probably benign
R7726:Peg10 UTSW 6 4756453 small insertion probably benign
X0065:Peg10 UTSW 6 4756515 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- CTGTTTACAGTGCCACAACCG -3'
(R):5'- CCAGCCATGTGGTAGAAGAATG -3'

Sequencing Primer
(F):5'- TCAGCATGAGCATCTGCATG -3'
(R):5'- TAGAAGAATGGTGGCTGCTG -3'
Posted On2019-05-15