Incidental Mutation 'R0599:Sulf2'
ID55194
Institutional Source Beutler Lab
Gene Symbol Sulf2
Ensembl Gene ENSMUSG00000006800
Gene Namesulfatase 2
Synonyms2010004N24Rik
MMRRC Submission 038788-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.325) question?
Stock #R0599 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location166073089-166155663 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 166083879 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 453 (T453A)
Ref Sequence ENSEMBL: ENSMUSP00000154557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088086] [ENSMUST00000109249] [ENSMUST00000146497]
Predicted Effect possibly damaging
Transcript: ENSMUST00000088086
AA Change: T453A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000085405
Gene: ENSMUSG00000006800
AA Change: T453A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Sulfatase 44 375 2.8e-50 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 533 669 5.6e-47 PFAM
low complexity region 702 720 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109249
AA Change: T453A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104872
Gene: ENSMUSG00000006800
AA Change: T453A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Sulfatase 44 375 2.8e-50 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 532 670 1.3e-46 PFAM
low complexity region 702 720 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000146497
AA Change: T453A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.1477 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heparan sulfate proteoglycans (HSPGs) act as coreceptors for numerous heparin-binding growth factors and cytokines and are involved in cell signaling. Heparan sulfate 6-O-endosulfatases, such as SULF2, selectively remove 6-O-sulfate groups from heparan sulfate. This activity modulates the effects of heparan sulfate by altering binding sites for signaling molecules (Dai et al., 2005 [PubMed 16192265]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous disruption of this gene may lead to a partially penetrant, strain-dependent phenotype of embryonic lethality, reduced postnatal body weight, lung abnormalities, brain malformations, and reduced fertility. Mice homozygous for a hypomorphic gene-trap allele display skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,552,245 L978P probably damaging Het
Abcb1a C T 5: 8,698,539 T290M probably benign Het
Abcd3 A T 3: 121,765,093 F585I probably damaging Het
Acan A G 7: 79,111,290 probably benign Het
Anxa6 T C 11: 54,979,466 D667G possibly damaging Het
Ap3m2 G T 8: 22,793,112 A208D possibly damaging Het
Arhgap17 A T 7: 123,303,790 probably benign Het
Bptf A G 11: 107,068,382 V1838A probably damaging Het
Brip1 T A 11: 86,152,737 M334L probably benign Het
Btbd10 C T 7: 113,335,309 probably benign Het
Btbd11 G A 10: 85,658,336 G1106D probably damaging Het
Cdh7 C A 1: 110,052,966 T208K probably damaging Het
Cnga4 A G 7: 105,405,818 Y100C probably damaging Het
Dnah10 G A 5: 124,800,953 V2644M probably damaging Het
Dnah9 T C 11: 65,965,689 D2882G probably damaging Het
Eapp T A 12: 54,685,962 K117M probably damaging Het
Eml3 T C 19: 8,939,063 V673A probably benign Het
Ephb4 G A 5: 137,369,855 C754Y probably damaging Het
Eps8l1 A G 7: 4,477,957 D33G possibly damaging Het
Farsa A G 8: 84,867,583 K321E probably damaging Het
Fry G A 5: 150,437,159 R2090Q probably damaging Het
Gm10283 A G 8: 60,501,224 probably benign Het
Grm4 A G 17: 27,431,490 I844T probably benign Het
Gtf2h3 A G 5: 124,588,628 D124G probably benign Het
Gulo A T 14: 65,990,441 D347E probably damaging Het
Hmcn1 A G 1: 150,609,801 F4350S possibly damaging Het
Hspg2 A G 4: 137,512,401 D473G probably damaging Het
Il17ra T A 6: 120,481,505 I539N probably damaging Het
Insrr A G 3: 87,813,133 E1026G probably damaging Het
Itga2 A T 13: 114,856,650 probably benign Het
Kdm1b A T 13: 47,058,810 D190V possibly damaging Het
Lima1 A T 15: 99,802,159 N146K probably damaging Het
Mettl7a3 A T 15: 100,335,383 N152Y possibly damaging Het
Mnt G T 11: 74,842,296 V85L probably benign Het
Mon2 T A 10: 123,026,065 probably benign Het
Mtf1 T C 4: 124,820,201 probably benign Het
Mylk4 T C 13: 32,712,754 probably null Het
Myo18b A C 5: 112,865,750 L780R probably damaging Het
Myo1e A G 9: 70,376,660 probably benign Het
Obscn A G 11: 59,073,696 S705P probably damaging Het
Ocrl A T X: 47,936,086 probably benign Het
Olfr1260 T C 2: 89,978,201 F141S probably benign Het
Olfr394 A T 11: 73,887,904 M156K probably benign Het
Olfr599 A G 7: 103,338,186 N44S probably damaging Het
Olfr639 A T 7: 104,012,188 C171* probably null Het
Otof T A 5: 30,370,705 K1931N probably damaging Het
Plcxd3 A G 15: 4,516,867 S118G probably damaging Het
Plcz1 T A 6: 140,028,542 Q58L probably benign Het
Proser1 C A 3: 53,479,064 P789Q probably benign Het
Rassf4 T C 6: 116,645,936 E38G probably damaging Het
Ros1 A T 10: 52,123,300 Y1164N probably damaging Het
Rpgrip1l A G 8: 91,305,000 I83T probably damaging Het
Scn9a T G 2: 66,526,799 K1053Q probably damaging Het
Sgsm1 G T 5: 113,245,028 Q1087K probably damaging Het
Slc16a10 T C 10: 40,141,918 D40G probably benign Het
Slc27a6 A G 18: 58,556,813 D117G probably damaging Het
Slc2a9 T A 5: 38,480,144 probably benign Het
Slc4a1 A G 11: 102,357,915 probably benign Het
Smarca1 T A X: 47,823,426 Q982L probably benign Het
Sp100 T A 1: 85,681,110 I320N possibly damaging Het
Stx8 A T 11: 68,109,362 R209S probably null Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tenm2 T A 11: 36,024,780 I1976F possibly damaging Het
Tenm3 G A 8: 48,277,710 S1341L probably damaging Het
Tmem130 C T 5: 144,737,809 V369M probably damaging Het
Tmem200c A G 17: 68,840,511 K30E probably damaging Het
Tmem225 A G 9: 40,149,747 I117V possibly damaging Het
Top2a A G 11: 99,001,417 I1073T probably damaging Het
Trps1 A C 15: 50,831,860 Y296* probably null Het
Tubg1 T C 11: 101,125,336 M377T probably benign Het
Vmn1r35 G A 6: 66,679,513 H58Y probably benign Het
Vmn1r56 G A 7: 5,196,430 H63Y probably benign Het
Vmn1r75 T C 7: 11,881,262 probably null Het
Vnn3 T C 10: 23,865,705 S303P possibly damaging Het
Wdr49 C T 3: 75,431,076 probably null Het
Wdr49 T C 3: 75,449,890 probably null Het
Zcchc6 A G 13: 59,809,487 V7A probably damaging Het
Zzef1 T C 11: 72,913,178 L2582P probably damaging Het
Other mutations in Sulf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Sulf2 APN 2 166094492 missense possibly damaging 0.48
IGL01353:Sulf2 APN 2 166087095 missense probably damaging 1.00
IGL02427:Sulf2 APN 2 166089298 missense probably damaging 0.99
IGL02602:Sulf2 APN 2 166081300 missense probably benign 0.32
IGL02681:Sulf2 APN 2 166116985 missense probably benign 0.01
IGL03047:Sulf2 APN 2 166080894 splice site probably null
PIT4468001:Sulf2 UTSW 2 166080800 missense probably benign
R0029:Sulf2 UTSW 2 166116973 missense possibly damaging 0.46
R0029:Sulf2 UTSW 2 166116973 missense possibly damaging 0.46
R0233:Sulf2 UTSW 2 166085669 splice site probably benign
R0332:Sulf2 UTSW 2 166089199 missense probably benign 0.00
R0411:Sulf2 UTSW 2 166093516 missense probably damaging 1.00
R0694:Sulf2 UTSW 2 166085791 missense probably damaging 1.00
R1594:Sulf2 UTSW 2 166084447 splice site probably benign
R1710:Sulf2 UTSW 2 166079072 missense probably benign
R1725:Sulf2 UTSW 2 166081361 missense probably damaging 0.96
R1737:Sulf2 UTSW 2 166082678 missense probably benign 0.01
R1775:Sulf2 UTSW 2 166079612 missense probably benign 0.07
R2001:Sulf2 UTSW 2 166080853 missense probably benign 0.05
R2570:Sulf2 UTSW 2 166085801 missense probably benign 0.21
R4052:Sulf2 UTSW 2 166094590 missense probably damaging 1.00
R4357:Sulf2 UTSW 2 166077577 missense probably benign 0.01
R4613:Sulf2 UTSW 2 166132605 missense probably damaging 1.00
R4790:Sulf2 UTSW 2 166089295 missense probably damaging 1.00
R4858:Sulf2 UTSW 2 166081604 missense probably benign 0.00
R5033:Sulf2 UTSW 2 166081622 missense probably benign 0.01
R5692:Sulf2 UTSW 2 166081506 missense probably benign 0.03
R5695:Sulf2 UTSW 2 166132758 missense probably benign 0.03
R6504:Sulf2 UTSW 2 166083921 missense probably benign 0.00
R6816:Sulf2 UTSW 2 166082754 missense probably benign
R6859:Sulf2 UTSW 2 166087119 missense probably damaging 1.00
R6873:Sulf2 UTSW 2 166089275 missense probably damaging 0.97
R7125:Sulf2 UTSW 2 166075528 nonsense probably null
R7329:Sulf2 UTSW 2 166117088 missense probably damaging 1.00
R7343:Sulf2 UTSW 2 166077616 missense possibly damaging 0.69
R7669:Sulf2 UTSW 2 166093596 missense possibly damaging 0.67
R7833:Sulf2 UTSW 2 166079536 missense possibly damaging 0.92
R7916:Sulf2 UTSW 2 166079536 missense possibly damaging 0.92
RF016:Sulf2 UTSW 2 166082603 missense probably benign 0.01
X0063:Sulf2 UTSW 2 166079133 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCGCAGAGAGTTATACCACACAAG -3'
(R):5'- AGTAGGTCTCCACAGAGCTATGCAG -3'

Sequencing Primer
(F):5'- GCAATGAATGCTGTTTGCCAC -3'
(R):5'- AGAGCTATGCAGGGCCG -3'
Posted On2013-07-11