Incidental Mutation 'R7120:Tkt'
ID551960
Institutional Source Beutler Lab
Gene Symbol Tkt
Ensembl Gene ENSMUSG00000021957
Gene Nametransketolase
Synonymsp68
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7120 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location30548359-30574720 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30559822 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 99 (N99S)
Ref Sequence ENSEMBL: ENSMUSP00000022529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022529] [ENSMUST00000162356]
Predicted Effect probably benign
Transcript: ENSMUST00000022529
AA Change: N99S

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000022529
Gene: ENSMUSG00000021957
AA Change: N99S

DomainStartEndE-ValueType
Pfam:Transketolase_N 14 284 1.4e-46 PFAM
Pfam:E1_dh 108 239 6.9e-11 PFAM
Transket_pyr 315 479 1.52e-42 SMART
Pfam:Transketolase_C 490 612 3.9e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162356
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an enzyme that binds magnesium and thiamine pyrophosphate and catalyzes the transfer of sugar phosphates to an aldose acceptor. This enzyme is a key component of the pentose phosphate pathway during glycolysis. It is significantly expressed in the cornea and may be involved in the cellular response against oxidative stress. Haploinsufficiency of this gene leads to decreased growth and reduction of adipose tissue. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygotes for a targeted null mutation die at or before the morula stage. Heterozygotes show reduced growth, decreased fat accumulation, microphthalmia, and reduced female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik A T 3: 36,481,867 Q94L unknown Het
4933411K16Rik C T 19: 42,052,673 A81V probably benign Het
Actr3 A C 1: 125,403,432 Y273* probably null Het
Aoc1 T A 6: 48,906,597 I469N probably damaging Het
Arhgef28 A T 13: 97,944,539 L1270Q probably damaging Het
Atp2c1 G A 9: 105,420,186 Q780* probably null Het
Bbs10 T C 10: 111,299,449 V141A possibly damaging Het
Bivm A T 1: 44,126,446 T19S probably benign Het
Cacna1h T G 17: 25,391,507 H675P probably benign Het
Cadps T A 14: 12,439,919 L1204F probably damaging Het
Cald1 T C 6: 34,686,076 probably null Het
Calr A G 8: 84,842,828 M357T probably damaging Het
Ccni A T 5: 93,183,331 Y260* probably null Het
Csrnp3 C A 2: 66,023,010 T594K probably damaging Het
Dek A T 13: 47,100,183 M152K unknown Het
Depdc1b T C 13: 108,362,247 W155R probably benign Het
Ehd1 A G 19: 6,297,561 K315R probably benign Het
Epn3 C A 11: 94,492,428 R323S probably benign Het
Fam57b T C 7: 126,829,333 L221P probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbxo10 T A 4: 45,040,533 K891* probably null Het
Fras1 G T 5: 96,752,960 G3013* probably null Het
Gbp2b A G 3: 142,606,746 T297A probably benign Het
Gbp7 T C 3: 142,543,973 S402P probably damaging Het
Gclc T C 9: 77,786,750 Y329H probably damaging Het
Gfpt1 A G 6: 87,087,393 H655R probably benign Het
Gm4787 C A 12: 81,378,486 M299I probably benign Het
Grb7 C A 11: 98,454,991 R532S probably benign Het
Hmcn1 A T 1: 150,700,541 I2066N probably damaging Het
Hnrnpll T C 17: 80,034,057 T518A probably benign Het
Hps3 G A 3: 20,011,541 R712W probably damaging Het
Hspd1 A G 1: 55,079,229 V406A probably benign Het
Igkv2-112 T C 6: 68,220,526 F61L probably benign Het
Iqcf5 G A 9: 106,515,796 R84H probably damaging Het
Itgad T A 7: 128,173,974 M1K probably null Het
Kmt2d A G 15: 98,861,065 S1292P unknown Het
Macc1 C A 12: 119,445,745 Q83K possibly damaging Het
Map3k4 G T 17: 12,271,467 A359E probably damaging Het
Mfap3 T A 11: 57,528,217 C68S probably damaging Het
Mipep C T 14: 60,875,247 R660C possibly damaging Het
Morc2b A T 17: 33,135,813 L995Q probably damaging Het
Mrc1 A G 2: 14,308,697 N913S probably damaging Het
N4bp1 C A 8: 86,860,867 C481F probably benign Het
Nae1 A G 8: 104,526,278 probably null Het
Nup214 T A 2: 32,051,042 V29E probably benign Het
Olfr251 T C 9: 38,378,649 L250P probably damaging Het
Olfr390 A T 11: 73,787,114 M59L probably damaging Het
Orai1 A G 5: 123,029,472 E236G possibly damaging Het
P2rx7 A G 5: 122,681,294 Y593C probably benign Het
Pcbp2 A G 15: 102,474,678 D77G possibly damaging Het
Pcdha8 G A 18: 36,993,787 V441M possibly damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Plaa A G 4: 94,582,682 S406P possibly damaging Het
Plekhh1 C A 12: 79,070,939 P903Q probably benign Het
Plekhh3 T C 11: 101,168,238 E92G probably damaging Het
Ptpn9 T C 9: 57,059,882 F463S probably damaging Het
Ptprn2 A C 12: 116,872,056 E337A probably benign Het
Rubcn C T 16: 32,836,469 R527Q probably damaging Het
Samd3 C T 10: 26,230,966 T73M possibly damaging Het
Sfxn4 T A 19: 60,852,039 K173* probably null Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Son T G 16: 91,670,526 N2258K unknown Het
Sspo A T 6: 48,465,571 H2000L probably benign Het
Syne1 C T 10: 5,293,971 S2731N probably benign Het
Syt6 T C 3: 103,587,357 Y213H probably damaging Het
Tmem258 G A 19: 10,204,238 probably benign Het
Tnks1bp1 T C 2: 85,072,097 S1702P probably damaging Het
Tpte A G 8: 22,327,673 D225G probably damaging Het
Trak1 T A 9: 121,460,498 F625L probably benign Het
Ttc33 G T 15: 5,212,007 C77F probably benign Het
Ugt1a2 A G 1: 88,200,800 H55R probably damaging Het
Vmn1r169 G T 7: 23,578,019 V279L probably benign Het
Vmn2r25 T C 6: 123,828,435 K488E possibly damaging Het
Vmn2r8 A T 5: 108,808,638 D39E possibly damaging Het
Other mutations in Tkt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Tkt APN 14 30569095 missense probably damaging 1.00
IGL02122:Tkt APN 14 30571201 missense possibly damaging 0.95
IGL02323:Tkt APN 14 30571035 missense possibly damaging 0.69
IGL02326:Tkt APN 14 30572225 missense probably damaging 0.99
IGL02554:Tkt APN 14 30558780 missense probably damaging 1.00
IGL03145:Tkt APN 14 30560688 splice site probably benign
R0148:Tkt UTSW 14 30572220 missense probably damaging 1.00
R0732:Tkt UTSW 14 30571140 splice site probably null
R1550:Tkt UTSW 14 30565568 missense probably damaging 1.00
R2218:Tkt UTSW 14 30567061 critical splice donor site probably null
R4464:Tkt UTSW 14 30568274 missense possibly damaging 0.86
R4771:Tkt UTSW 14 30567025 missense probably damaging 0.97
R4998:Tkt UTSW 14 30565542 nonsense probably null
R5123:Tkt UTSW 14 30565646 missense probably benign 0.11
R5240:Tkt UTSW 14 30565678 missense probably damaging 1.00
R5283:Tkt UTSW 14 30560618 missense probably damaging 1.00
R5777:Tkt UTSW 14 30558776 missense possibly damaging 0.88
R6051:Tkt UTSW 14 30568196 missense probably benign 0.27
R6517:Tkt UTSW 14 30549323 missense probably damaging 0.96
R6645:Tkt UTSW 14 30570211 missense probably damaging 1.00
R6722:Tkt UTSW 14 30569084 missense probably damaging 1.00
R7179:Tkt UTSW 14 30559858 missense probably damaging 1.00
R7272:Tkt UTSW 14 30565607 missense probably damaging 1.00
R7274:Tkt UTSW 14 30569145 splice site probably null
R7402:Tkt UTSW 14 30558798 missense probably damaging 1.00
R7423:Tkt UTSW 14 30571035 missense possibly damaging 0.69
R7522:Tkt UTSW 14 30568223 missense possibly damaging 0.52
R7712:Tkt UTSW 14 30558806 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATGATCCCAGCAGCTCTG -3'
(R):5'- TCAGTACAAGAACTTGCCCCG -3'

Sequencing Primer
(F):5'- GCCCATGCGCTGTAGGAATG -3'
(R):5'- AAGAACTTGCCCCGTGCTG -3'
Posted On2019-05-15