Incidental Mutation 'R7121:Ccdc148'
ID 551981
Institutional Source Beutler Lab
Gene Symbol Ccdc148
Ensembl Gene ENSMUSG00000036641
Gene Name coiled-coil domain containing 148
Synonyms
MMRRC Submission 045210-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R7121 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 58711082-58991027 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 58717579 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 475 (Y475N)
Ref Sequence ENSEMBL: ENSMUSP00000076871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077687] [ENSMUST00000226455]
AlphaFold Q6P5U8
Predicted Effect probably damaging
Transcript: ENSMUST00000077687
AA Change: Y475N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076871
Gene: ENSMUSG00000036641
AA Change: Y475N

DomainStartEndE-ValueType
coiled coil region 173 195 N/A INTRINSIC
coiled coil region 289 353 N/A INTRINSIC
low complexity region 369 382 N/A INTRINSIC
coiled coil region 401 438 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000226455
AA Change: Y547N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (71/72)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik C T 19: 42,041,112 (GRCm39) A81V probably benign Het
Abcc9 A T 6: 142,634,853 (GRCm39) L137* probably null Het
Akap10 A G 11: 61,777,524 (GRCm39) probably null Het
Alms1 T A 6: 85,601,604 (GRCm39) Y1683N probably damaging Het
Atl1 A G 12: 69,978,408 (GRCm39) S127G probably damaging Het
Cadm1 G A 9: 47,710,708 (GRCm39) V204M probably damaging Het
Cbr3 T A 16: 93,487,438 (GRCm39) I207N probably damaging Het
Ccdc33 A T 9: 57,988,167 (GRCm39) S144T probably benign Het
Ceacam5 C A 7: 17,479,462 (GRCm39) A193E probably benign Het
Chd2 T C 7: 73,119,418 (GRCm39) D1042G probably benign Het
Chmp5 A T 4: 40,952,217 (GRCm39) probably null Het
Clca3a1 T A 3: 144,717,567 (GRCm39) N467I probably damaging Het
D130040H23Rik T C 8: 69,754,931 (GRCm39) V112A probably damaging Het
Dbh A T 2: 27,058,318 (GRCm39) D162V probably damaging Het
Dnah12 G A 14: 26,500,869 (GRCm39) probably null Het
Dnm2 C T 9: 21,385,862 (GRCm39) T295I probably benign Het
Faiml A C 9: 99,116,446 (GRCm39) D81E probably benign Het
Fer1l4 T A 2: 155,886,477 (GRCm39) Y720F probably benign Het
Fn1 A C 1: 71,639,697 (GRCm39) probably benign Het
Ftsj3 T C 11: 106,143,123 (GRCm39) E397G probably damaging Het
Gm16506 T C 14: 43,964,817 (GRCm39) K42E Het
Gpr179 A G 11: 97,225,556 (GRCm39) S2200P probably benign Het
Gusb T C 5: 130,028,884 (GRCm39) D202G probably benign Het
Hspe1 A G 1: 55,128,310 (GRCm39) E35G probably damaging Het
Kptn T A 7: 15,857,023 (GRCm39) H170Q probably damaging Het
Lama3 G A 18: 12,595,839 (GRCm39) A923T probably benign Het
Lmo7 T A 14: 102,124,471 (GRCm39) I432K probably damaging Het
Maneal G A 4: 124,750,905 (GRCm39) P284S probably benign Het
Mrgbp A G 2: 180,224,682 (GRCm39) T28A probably benign Het
Myo1h T C 5: 114,476,290 (GRCm39) V493A Het
Naxd T C 8: 11,556,745 (GRCm39) L122P probably damaging Het
Neto2 T C 8: 86,397,020 (GRCm39) probably null Het
Obscn T A 11: 58,904,078 (GRCm39) R7299* probably null Het
Odf2l G A 3: 144,845,581 (GRCm39) V363I possibly damaging Het
Or2g25 T C 17: 37,970,699 (GRCm39) H175R probably damaging Het
Or2t35 A G 14: 14,407,998 (GRCm38) T257A possibly damaging Het
Or4c100 A T 2: 88,356,170 (GRCm39) D81V probably damaging Het
Or52a5b A T 7: 103,416,940 (GRCm39) Y221* probably null Het
Or5b105 T A 19: 13,080,537 (GRCm39) I44F probably benign Het
Otud3 G A 4: 138,624,067 (GRCm39) P325L probably benign Het
Palb2 T C 7: 121,724,057 (GRCm39) N564S probably benign Het
Pcnt A G 10: 76,263,761 (GRCm39) V401A possibly damaging Het
Plcd4 G A 1: 74,604,524 (GRCm39) E767K probably benign Het
Ppp3ca T C 3: 136,574,387 (GRCm39) F95S probably damaging Het
Prkar2a A G 9: 108,569,821 (GRCm39) T56A probably benign Het
Psma2 T A 13: 14,799,815 (GRCm39) D186E probably benign Het
Psmd11 T A 11: 80,329,099 (GRCm39) Y72* probably null Het
Ror1 G A 4: 100,160,142 (GRCm39) D53N probably benign Het
Rubcn C T 16: 32,656,839 (GRCm39) R527Q probably damaging Het
Sgca G A 11: 94,860,373 (GRCm39) P255S possibly damaging Het
Skint11 A T 4: 114,084,993 (GRCm39) R167S probably benign Het
Slco5a1 A G 1: 13,060,661 (GRCm39) V20A probably benign Het
Snai2 T C 16: 14,524,970 (GRCm39) S159P probably benign Het
Taar2 T G 10: 23,816,725 (GRCm39) S88R probably damaging Het
Tacc3 T A 5: 33,824,509 (GRCm39) N378K possibly damaging Het
Tek A G 4: 94,699,647 (GRCm39) K342E probably benign Het
Tm9sf3 G T 19: 41,233,944 (GRCm39) S198* probably null Het
Tmbim4 T A 10: 120,051,514 (GRCm39) F56I possibly damaging Het
Tsen34 T A 7: 3,697,986 (GRCm39) S85T probably benign Het
Ttc27 C A 17: 75,054,710 (GRCm39) Q339K probably benign Het
Ubap2 G T 4: 41,205,550 (GRCm39) P636T probably benign Het
Ubr1 G A 2: 120,705,979 (GRCm39) L1495F probably benign Het
Vsig10 T C 5: 117,481,967 (GRCm39) S386P probably damaging Het
Wnk2 C A 13: 49,300,653 (GRCm39) R19L probably benign Het
Wsb2 T C 5: 117,508,944 (GRCm39) L126P probably damaging Het
Xylb A G 9: 119,211,358 (GRCm39) I402V probably benign Het
Yrdc A G 4: 124,744,748 (GRCm39) S61G probably benign Het
Zbtb3 A G 19: 8,780,771 (GRCm39) D128G probably damaging Het
Zfp423 C T 8: 88,507,489 (GRCm39) G952R probably damaging Het
Zfp646 A G 7: 127,478,944 (GRCm39) T374A possibly damaging Het
Other mutations in Ccdc148
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Ccdc148 APN 2 58,719,811 (GRCm39) missense probably benign 0.00
IGL02056:Ccdc148 APN 2 58,894,081 (GRCm39) splice site probably benign
IGL02470:Ccdc148 APN 2 58,891,911 (GRCm39) missense probably damaging 0.96
PIT4585001:Ccdc148 UTSW 2 58,872,988 (GRCm39) missense probably benign 0.01
R0068:Ccdc148 UTSW 2 58,717,629 (GRCm39) missense probably benign
R0068:Ccdc148 UTSW 2 58,717,629 (GRCm39) missense probably benign
R0348:Ccdc148 UTSW 2 58,894,084 (GRCm39) splice site probably null
R1464:Ccdc148 UTSW 2 58,824,455 (GRCm39) missense probably damaging 1.00
R1464:Ccdc148 UTSW 2 58,824,455 (GRCm39) missense probably damaging 1.00
R1464:Ccdc148 UTSW 2 58,796,374 (GRCm39) nonsense probably null
R1464:Ccdc148 UTSW 2 58,796,374 (GRCm39) nonsense probably null
R1675:Ccdc148 UTSW 2 58,870,566 (GRCm39) missense probably damaging 0.96
R1677:Ccdc148 UTSW 2 58,892,176 (GRCm39) missense probably damaging 1.00
R1832:Ccdc148 UTSW 2 58,891,911 (GRCm39) missense probably damaging 0.96
R1918:Ccdc148 UTSW 2 58,872,911 (GRCm39) missense probably damaging 1.00
R2114:Ccdc148 UTSW 2 58,892,128 (GRCm39) missense probably damaging 1.00
R2115:Ccdc148 UTSW 2 58,892,128 (GRCm39) missense probably damaging 1.00
R4657:Ccdc148 UTSW 2 58,891,900 (GRCm39) missense probably benign 0.04
R4921:Ccdc148 UTSW 2 58,719,814 (GRCm39) missense probably damaging 1.00
R5022:Ccdc148 UTSW 2 58,717,644 (GRCm39) missense probably damaging 1.00
R5809:Ccdc148 UTSW 2 58,713,657 (GRCm39) missense probably damaging 1.00
R6164:Ccdc148 UTSW 2 58,713,645 (GRCm39) missense probably damaging 1.00
R6952:Ccdc148 UTSW 2 58,713,657 (GRCm39) missense probably damaging 1.00
R6987:Ccdc148 UTSW 2 58,872,926 (GRCm39) missense probably damaging 1.00
R7452:Ccdc148 UTSW 2 58,717,596 (GRCm39) missense probably damaging 1.00
R7493:Ccdc148 UTSW 2 58,899,160 (GRCm39) missense probably damaging 1.00
R7574:Ccdc148 UTSW 2 58,713,645 (GRCm39) missense probably damaging 1.00
R7666:Ccdc148 UTSW 2 58,824,512 (GRCm39) missense probably damaging 0.99
R7763:Ccdc148 UTSW 2 58,713,648 (GRCm39) missense probably benign
R8045:Ccdc148 UTSW 2 58,892,083 (GRCm39) critical splice donor site probably null
R8865:Ccdc148 UTSW 2 58,719,832 (GRCm39) missense possibly damaging 0.86
R8932:Ccdc148 UTSW 2 58,894,054 (GRCm39) missense probably benign 0.40
R9597:Ccdc148 UTSW 2 58,893,397 (GRCm39) missense probably benign 0.08
X0062:Ccdc148 UTSW 2 58,893,460 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGTGACAGATACGATTTTAAGCTG -3'
(R):5'- AACCCATAGTCTTACGCAGAAG -3'

Sequencing Primer
(F):5'- AAGCTGTTTTGTTTTATGTCACACTC -3'
(R):5'- GCGTTTAGCTCGTACCCC -3'
Posted On 2019-05-15