Mutagenetix > Incidental Mutations

Incidental Mutation 'R7121:Olfr1186'

551982

Institutional Source

Beutler Lab

Gene Symbol

Olfr1186

Ensembl Gene

ENSMUSG00000082882

Gene Name

olfactory receptor 1186

Synonyms

GA_x6K02T2Q125-50012960-50013871, MOR230-5

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.079) question?

Stock #

R7121 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

88518551-88526790 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 88525826 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 81 (D81V)

Ref Sequence

ENSEMBL: ENSMUSP00000151114 (fasta)

Predicted Effect

probably damaging
Transcript: ENSMUST00000121619
AA Change: D81V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Predicted Effect

probably damaging
Transcript: ENSMUST00000215912
AA Change: D81V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Predicted Effect

probably damaging
Transcript: ENSMUST00000216978
AA Change: D81V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

99% (71/72)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933411K16Rik	C	T	19: 42,052,673	A81V	probably benign	Het
Abcc9	A	T	6: 142,689,127	L137*	probably null	Het
Akap10	A	G	11: 61,886,698		probably null	Het
Alms1	T	A	6: 85,624,622	Y1683N	probably damaging	Het
Atl1	A	G	12: 69,931,634	S127G	probably damaging	Het
Cadm1	G	A	9: 47,799,410	V204M	probably damaging	Het
Cbr3	T	A	16: 93,690,550	I207N	probably damaging	Het
Ccdc148	A	T	2: 58,827,567	Y475N	probably damaging	Het
Ccdc33	A	T	9: 58,080,884	S144T	probably benign	Het
Ceacam5	C	A	7: 17,745,537	A193E	probably benign	Het
Chd2	T	C	7: 73,469,670	D1042G	probably benign	Het
Chmp5	A	T	4: 40,952,217		probably null	Het
Clca1	T	A	3: 145,011,806	N467I	probably damaging	Het
D130040H23Rik	T	C	8: 69,302,279	V112A	probably damaging	Het
Dbh	A	T	2: 27,168,306	D162V	probably damaging	Het
Dnah12	G	A	14: 26,778,912		probably null	Het
Dnm2	C	T	9: 21,474,566	T295I	probably benign	Het
Faiml	A	C	9: 99,234,393	D81E	probably benign	Het
Fer1l4	T	A	2: 156,044,557	Y720F	probably benign	Het
Fn1	A	C	1: 71,600,538		probably benign	Het
Ftsj3	T	C	11: 106,252,297	E397G	probably damaging	Het
Gm16506	T	C	14: 43,727,360	K42E		Het
Gpr179	A	G	11: 97,334,730	S2200P	probably benign	Het
Gusb	T	C	5: 130,000,043	D202G	probably benign	Het
Hspe1	A	G	1: 55,089,151	E35G	probably damaging	Het
Kptn	T	A	7: 16,123,098	H170Q	probably damaging	Het
Lama3	G	A	18: 12,462,782	A923T	probably benign	Het
Lmo7	T	A	14: 101,887,035	I432K	probably damaging	Het
Maneal	G	A	4: 124,857,112	P284S	probably benign	Het
Mrgbp	A	G	2: 180,582,889	T28A	probably benign	Het
Myo1h	T	C	5: 114,338,229	V493A		Het
Naxd	T	C	8: 11,506,745	L122P	probably damaging	Het
Neto2	T	C	8: 85,670,391		probably null	Het
Obscn	T	A	11: 59,013,252	R7299*	probably null	Het
Odf2l	G	A	3: 145,139,820	V363I	possibly damaging	Het
Olfr117	T	C	17: 37,659,808	H175R	probably damaging	Het
Olfr1458	T	A	19: 13,103,173	I44F	probably benign	Het
Olfr69	A	T	7: 103,767,733	Y221*	probably null	Het
Olfr721-ps1	A	G	14: 14,407,998	T257A	possibly damaging	Het
Otud3	G	A	4: 138,896,756	P325L	probably benign	Het
Palb2	T	C	7: 122,124,834	N564S	probably benign	Het
Pcnt	A	G	10: 76,427,927	V401A	possibly damaging	Het
Plcd4	G	A	1: 74,565,365	E767K	probably benign	Het
Ppp3ca	T	C	3: 136,868,626	F95S	probably damaging	Het
Prkar2a	A	G	9: 108,692,622	T56A	probably benign	Het
Psma2	T	A	13: 14,625,230	D186E	probably benign	Het
Psmd11	T	A	11: 80,438,273	Y72*	probably null	Het
Ror1	G	A	4: 100,302,945	D53N	probably benign	Het
Rubcn	C	T	16: 32,836,469	R527Q	probably damaging	Het
Sgca	G	A	11: 94,969,547	P255S	possibly damaging	Het
Skint11	A	T	4: 114,227,796	R167S	probably benign	Het
Slco5a1	A	G	1: 12,990,437	V20A	probably benign	Het
Snai2	T	C	16: 14,707,106	S159P	probably benign	Het
Taar2	T	G	10: 23,940,827	S88R	probably damaging	Het
Tacc3	T	A	5: 33,667,165	N378K	possibly damaging	Het
Tek	A	G	4: 94,811,410	K342E	probably benign	Het
Tm9sf3	G	T	19: 41,245,505	S198*	probably null	Het
Tmbim4	T	A	10: 120,215,609	F56I	possibly damaging	Het
Tsen34	T	A	7: 3,694,987	S85T	probably benign	Het
Ttc27	C	A	17: 74,747,715	Q339K	probably benign	Het
Ubap2	G	T	4: 41,205,550	P636T	probably benign	Het
Ubr1	G	A	2: 120,875,498	L1495F	probably benign	Het
Vsig10	T	C	5: 117,343,902	S386P	probably damaging	Het
Wnk2	C	A	13: 49,147,177	R19L	probably benign	Het
Wsb2	T	C	5: 117,370,879	L126P	probably damaging	Het
Xylb	A	G	9: 119,382,292	I402V	probably benign	Het
Yrdc	A	G	4: 124,850,955	S61G	probably benign	Het
Zbtb3	A	G	19: 8,803,407	D128G	probably damaging	Het
Zfp423	C	T	8: 87,780,861	G952R	probably damaging	Het
Zfp646	A	G	7: 127,879,772	T374A	possibly damaging	Het

Other mutations in Olfr1186

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01311:Olfr1186	APN	2	88525760	missense	possibly damaging	0.87
IGL01727:Olfr1186	APN	2	88525927	missense	probably benign	0.03
IGL01790:Olfr1186	APN	2	88526423	missense	probably damaging	0.99
IGL01868:Olfr1186	APN	2	88525715	missense	possibly damaging	0.66
IGL03146:Olfr1186	APN	2	88526144	missense	possibly damaging	0.90
IGL03378:Olfr1186	APN	2	88526154	nonsense	probably null
R0053:Olfr1186	UTSW	2	88526163	missense	probably damaging	1.00
R0829:Olfr1186	UTSW	2	88526228	missense	probably damaging	1.00
R1210:Olfr1186	UTSW	2	88526276	missense	possibly damaging	0.89
R1754:Olfr1186	UTSW	2	88525815	missense	probably damaging	0.99
R2260:Olfr1186	UTSW	2	88526386	missense	possibly damaging	0.93
R3426:Olfr1186	UTSW	2	88525864	missense	probably damaging	1.00
R3781:Olfr1186	UTSW	2	88526365	missense	probably benign	0.23
R4737:Olfr1186	UTSW	2	88526225	missense	probably damaging	1.00
R4908:Olfr1186	UTSW	2	88525910	missense	probably damaging	1.00
R4932:Olfr1186	UTSW	2	88525735	missense	probably benign	0.02
R5071:Olfr1186	UTSW	2	88526041	missense	probably damaging	1.00
R5831:Olfr1186	UTSW	2	88526480	nonsense	probably null
R6222:Olfr1186	UTSW	2	88499270	missense	probably benign	0.34
R6370:Olfr1186	UTSW	2	88499368	nonsense	probably null
R6802:Olfr1186	UTSW	2	88525597	missense	probably benign	0.02
R6931:Olfr1186	UTSW	2	88526194	missense	possibly damaging	0.50
R7044:Olfr1186	UTSW	2	88526486	missense	probably benign
R7166:Olfr1186	UTSW	2	88525646	missense	possibly damaging	0.89
R7387:Olfr1186	UTSW	2	88526400	nonsense	probably null
R7891:Olfr1186	UTSW	2	88525945	missense	probably benign	0.04
R7951:Olfr1186	UTSW	2	88525804	missense	probably damaging	0.98
R7978:Olfr1186	UTSW	2	88525670	nonsense	probably null
R8016:Olfr1186	UTSW	2	88526173	missense	probably damaging	0.99
R8039:Olfr1186	UTSW	2	88525871	missense	probably benign	0.07
R8389:Olfr1186	UTSW	2	88525587	start codon destroyed	probably null

Predicted Primers

PCR Primer
(F):5'- TGGGTTGACACAGGATCCAG -3'
(R):5'- TGAATACACGACCCTATCCAGG -3'

Sequencing Primer
(F):5'- CAGAAGGCAATATTTGGAGTCTTC -3'
(R):5'- CTAATACACCACAGATATGTTGGCTC -3'

Posted On

2019-05-15