Incidental Mutation 'R7121:Fer1l4'
ID 551984
Institutional Source Beutler Lab
Gene Symbol Fer1l4
Ensembl Gene ENSMUSG00000013338
Gene Name fer-1 like family member 4
Synonyms 9130402C12Rik
MMRRC Submission 045210-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7121 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 155861059-155894867 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 155886477 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 720 (Y720F)
Ref Sequence ENSEMBL: ENSMUSP00000105240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109611]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000109611
AA Change: Y720F

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000105240
Gene: ENSMUSG00000013338
AA Change: Y720F

DomainStartEndE-ValueType
PDB:3L9B|A 1 122 1e-12 PDB
Blast:C2 2 96 2e-51 BLAST
low complexity region 159 172 N/A INTRINSIC
low complexity region 178 197 N/A INTRINSIC
C2 228 329 2.87e-7 SMART
FerI 312 383 7.93e-29 SMART
C2 391 501 3.64e-9 SMART
low complexity region 574 581 N/A INTRINSIC
low complexity region 611 622 N/A INTRINSIC
low complexity region 829 837 N/A INTRINSIC
low complexity region 844 855 N/A INTRINSIC
FerB 861 932 7.27e-37 SMART
C2 968 1076 3.73e-6 SMART
low complexity region 1249 1257 N/A INTRINSIC
low complexity region 1280 1310 N/A INTRINSIC
low complexity region 1327 1340 N/A INTRINSIC
low complexity region 1397 1407 N/A INTRINSIC
C2 1449 1548 5.65e-15 SMART
C2 1692 1822 4.22e-5 SMART
Pfam:Ferlin_C 1834 1987 1.6e-74 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (71/72)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik C T 19: 42,041,112 (GRCm39) A81V probably benign Het
Abcc9 A T 6: 142,634,853 (GRCm39) L137* probably null Het
Akap10 A G 11: 61,777,524 (GRCm39) probably null Het
Alms1 T A 6: 85,601,604 (GRCm39) Y1683N probably damaging Het
Atl1 A G 12: 69,978,408 (GRCm39) S127G probably damaging Het
Cadm1 G A 9: 47,710,708 (GRCm39) V204M probably damaging Het
Cbr3 T A 16: 93,487,438 (GRCm39) I207N probably damaging Het
Ccdc148 A T 2: 58,717,579 (GRCm39) Y475N probably damaging Het
Ccdc33 A T 9: 57,988,167 (GRCm39) S144T probably benign Het
Ceacam5 C A 7: 17,479,462 (GRCm39) A193E probably benign Het
Chd2 T C 7: 73,119,418 (GRCm39) D1042G probably benign Het
Chmp5 A T 4: 40,952,217 (GRCm39) probably null Het
Clca3a1 T A 3: 144,717,567 (GRCm39) N467I probably damaging Het
D130040H23Rik T C 8: 69,754,931 (GRCm39) V112A probably damaging Het
Dbh A T 2: 27,058,318 (GRCm39) D162V probably damaging Het
Dnah12 G A 14: 26,500,869 (GRCm39) probably null Het
Dnm2 C T 9: 21,385,862 (GRCm39) T295I probably benign Het
Faiml A C 9: 99,116,446 (GRCm39) D81E probably benign Het
Fn1 A C 1: 71,639,697 (GRCm39) probably benign Het
Ftsj3 T C 11: 106,143,123 (GRCm39) E397G probably damaging Het
Gm16506 T C 14: 43,964,817 (GRCm39) K42E Het
Gpr179 A G 11: 97,225,556 (GRCm39) S2200P probably benign Het
Gusb T C 5: 130,028,884 (GRCm39) D202G probably benign Het
Hspe1 A G 1: 55,128,310 (GRCm39) E35G probably damaging Het
Kptn T A 7: 15,857,023 (GRCm39) H170Q probably damaging Het
Lama3 G A 18: 12,595,839 (GRCm39) A923T probably benign Het
Lmo7 T A 14: 102,124,471 (GRCm39) I432K probably damaging Het
Maneal G A 4: 124,750,905 (GRCm39) P284S probably benign Het
Mrgbp A G 2: 180,224,682 (GRCm39) T28A probably benign Het
Myo1h T C 5: 114,476,290 (GRCm39) V493A Het
Naxd T C 8: 11,556,745 (GRCm39) L122P probably damaging Het
Neto2 T C 8: 86,397,020 (GRCm39) probably null Het
Obscn T A 11: 58,904,078 (GRCm39) R7299* probably null Het
Odf2l G A 3: 144,845,581 (GRCm39) V363I possibly damaging Het
Or2g25 T C 17: 37,970,699 (GRCm39) H175R probably damaging Het
Or2t35 A G 14: 14,407,998 (GRCm38) T257A possibly damaging Het
Or4c100 A T 2: 88,356,170 (GRCm39) D81V probably damaging Het
Or52a5b A T 7: 103,416,940 (GRCm39) Y221* probably null Het
Or5b105 T A 19: 13,080,537 (GRCm39) I44F probably benign Het
Otud3 G A 4: 138,624,067 (GRCm39) P325L probably benign Het
Palb2 T C 7: 121,724,057 (GRCm39) N564S probably benign Het
Pcnt A G 10: 76,263,761 (GRCm39) V401A possibly damaging Het
Plcd4 G A 1: 74,604,524 (GRCm39) E767K probably benign Het
Ppp3ca T C 3: 136,574,387 (GRCm39) F95S probably damaging Het
Prkar2a A G 9: 108,569,821 (GRCm39) T56A probably benign Het
Psma2 T A 13: 14,799,815 (GRCm39) D186E probably benign Het
Psmd11 T A 11: 80,329,099 (GRCm39) Y72* probably null Het
Ror1 G A 4: 100,160,142 (GRCm39) D53N probably benign Het
Rubcn C T 16: 32,656,839 (GRCm39) R527Q probably damaging Het
Sgca G A 11: 94,860,373 (GRCm39) P255S possibly damaging Het
Skint11 A T 4: 114,084,993 (GRCm39) R167S probably benign Het
Slco5a1 A G 1: 13,060,661 (GRCm39) V20A probably benign Het
Snai2 T C 16: 14,524,970 (GRCm39) S159P probably benign Het
Taar2 T G 10: 23,816,725 (GRCm39) S88R probably damaging Het
Tacc3 T A 5: 33,824,509 (GRCm39) N378K possibly damaging Het
Tek A G 4: 94,699,647 (GRCm39) K342E probably benign Het
Tm9sf3 G T 19: 41,233,944 (GRCm39) S198* probably null Het
Tmbim4 T A 10: 120,051,514 (GRCm39) F56I possibly damaging Het
Tsen34 T A 7: 3,697,986 (GRCm39) S85T probably benign Het
Ttc27 C A 17: 75,054,710 (GRCm39) Q339K probably benign Het
Ubap2 G T 4: 41,205,550 (GRCm39) P636T probably benign Het
Ubr1 G A 2: 120,705,979 (GRCm39) L1495F probably benign Het
Vsig10 T C 5: 117,481,967 (GRCm39) S386P probably damaging Het
Wnk2 C A 13: 49,300,653 (GRCm39) R19L probably benign Het
Wsb2 T C 5: 117,508,944 (GRCm39) L126P probably damaging Het
Xylb A G 9: 119,211,358 (GRCm39) I402V probably benign Het
Yrdc A G 4: 124,744,748 (GRCm39) S61G probably benign Het
Zbtb3 A G 19: 8,780,771 (GRCm39) D128G probably damaging Het
Zfp423 C T 8: 88,507,489 (GRCm39) G952R probably damaging Het
Zfp646 A G 7: 127,478,944 (GRCm39) T374A possibly damaging Het
Other mutations in Fer1l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Fer1l4 APN 2 155,861,840 (GRCm39) nonsense probably null
IGL01025:Fer1l4 APN 2 155,894,105 (GRCm39) missense probably benign 0.41
IGL01103:Fer1l4 APN 2 155,886,361 (GRCm39) critical splice donor site probably null
IGL01322:Fer1l4 APN 2 155,862,259 (GRCm39) splice site probably null
IGL01391:Fer1l4 APN 2 155,878,376 (GRCm39) missense probably damaging 1.00
IGL02176:Fer1l4 APN 2 155,890,371 (GRCm39) missense probably benign
IGL02267:Fer1l4 APN 2 155,873,172 (GRCm39) missense possibly damaging 0.60
IGL02291:Fer1l4 APN 2 155,861,458 (GRCm39) missense probably damaging 1.00
IGL02385:Fer1l4 APN 2 155,887,348 (GRCm39) missense probably benign 0.04
IGL02423:Fer1l4 APN 2 155,894,827 (GRCm39) missense probably benign 0.04
IGL02596:Fer1l4 APN 2 155,881,052 (GRCm39) missense probably benign
IGL02612:Fer1l4 APN 2 155,889,848 (GRCm39) missense probably damaging 1.00
IGL02716:Fer1l4 APN 2 155,871,635 (GRCm39) missense probably damaging 1.00
IGL02738:Fer1l4 APN 2 155,887,648 (GRCm39) missense probably benign
IGL03035:Fer1l4 APN 2 155,864,526 (GRCm39) missense possibly damaging 0.95
IGL03083:Fer1l4 APN 2 155,881,286 (GRCm39) unclassified probably benign
IGL03201:Fer1l4 APN 2 155,886,650 (GRCm39) missense probably benign 0.32
IGL03349:Fer1l4 APN 2 155,886,654 (GRCm39) nonsense probably null
R0033:Fer1l4 UTSW 2 155,866,026 (GRCm39) splice site probably benign
R0356:Fer1l4 UTSW 2 155,865,930 (GRCm39) missense probably damaging 1.00
R0477:Fer1l4 UTSW 2 155,894,806 (GRCm39) missense probably benign 0.43
R0504:Fer1l4 UTSW 2 155,894,115 (GRCm39) missense probably benign 0.36
R0731:Fer1l4 UTSW 2 155,865,990 (GRCm39) missense probably benign 0.17
R0800:Fer1l4 UTSW 2 155,887,583 (GRCm39) missense possibly damaging 0.90
R0884:Fer1l4 UTSW 2 155,861,233 (GRCm39) missense possibly damaging 0.93
R1017:Fer1l4 UTSW 2 155,891,398 (GRCm39) critical splice acceptor site probably null
R1266:Fer1l4 UTSW 2 155,888,169 (GRCm39) missense possibly damaging 0.89
R1544:Fer1l4 UTSW 2 155,887,553 (GRCm39) missense probably benign 0.00
R1657:Fer1l4 UTSW 2 155,877,518 (GRCm39) missense possibly damaging 0.95
R1699:Fer1l4 UTSW 2 155,871,605 (GRCm39) missense probably benign 0.14
R1816:Fer1l4 UTSW 2 155,877,119 (GRCm39) missense probably damaging 0.98
R1950:Fer1l4 UTSW 2 155,890,194 (GRCm39) missense probably damaging 1.00
R2117:Fer1l4 UTSW 2 155,881,038 (GRCm39) missense probably benign 0.00
R2219:Fer1l4 UTSW 2 155,873,684 (GRCm39) missense probably damaging 0.99
R2220:Fer1l4 UTSW 2 155,873,684 (GRCm39) missense probably damaging 0.99
R2879:Fer1l4 UTSW 2 155,894,120 (GRCm39) missense probably damaging 1.00
R3746:Fer1l4 UTSW 2 155,876,968 (GRCm39) missense probably benign 0.01
R3806:Fer1l4 UTSW 2 155,887,603 (GRCm39) missense probably damaging 1.00
R3807:Fer1l4 UTSW 2 155,887,603 (GRCm39) missense probably damaging 1.00
R4224:Fer1l4 UTSW 2 155,862,309 (GRCm39) missense probably benign 0.37
R4274:Fer1l4 UTSW 2 155,862,464 (GRCm39) missense probably damaging 1.00
R4569:Fer1l4 UTSW 2 155,878,559 (GRCm39) missense possibly damaging 0.77
R4619:Fer1l4 UTSW 2 155,889,007 (GRCm39) missense probably damaging 1.00
R4707:Fer1l4 UTSW 2 155,887,543 (GRCm39) missense possibly damaging 0.69
R4914:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4915:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4917:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4918:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4941:Fer1l4 UTSW 2 155,887,009 (GRCm39) missense probably damaging 1.00
R5011:Fer1l4 UTSW 2 155,873,135 (GRCm39) missense probably damaging 1.00
R5013:Fer1l4 UTSW 2 155,873,135 (GRCm39) missense probably damaging 1.00
R5130:Fer1l4 UTSW 2 155,891,386 (GRCm39) missense possibly damaging 0.54
R5385:Fer1l4 UTSW 2 155,879,286 (GRCm39) nonsense probably null
R5441:Fer1l4 UTSW 2 155,865,177 (GRCm39) missense probably benign 0.00
R5555:Fer1l4 UTSW 2 155,890,109 (GRCm39) missense probably damaging 1.00
R5838:Fer1l4 UTSW 2 155,893,913 (GRCm39) missense probably benign 0.01
R6125:Fer1l4 UTSW 2 155,888,907 (GRCm39) missense probably damaging 1.00
R6184:Fer1l4 UTSW 2 155,890,211 (GRCm39) missense probably damaging 1.00
R6246:Fer1l4 UTSW 2 155,866,902 (GRCm39) missense probably damaging 0.99
R6248:Fer1l4 UTSW 2 155,888,091 (GRCm39) missense probably damaging 1.00
R6274:Fer1l4 UTSW 2 155,871,188 (GRCm39) missense probably damaging 1.00
R6298:Fer1l4 UTSW 2 155,866,660 (GRCm39) missense probably damaging 1.00
R6362:Fer1l4 UTSW 2 155,890,170 (GRCm39) missense probably benign 0.08
R6490:Fer1l4 UTSW 2 155,889,834 (GRCm39) missense possibly damaging 0.94
R6494:Fer1l4 UTSW 2 155,887,390 (GRCm39) missense probably benign 0.02
R6516:Fer1l4 UTSW 2 155,877,119 (GRCm39) missense probably damaging 0.98
R6530:Fer1l4 UTSW 2 155,889,785 (GRCm39) critical splice donor site probably null
R6740:Fer1l4 UTSW 2 155,873,142 (GRCm39) missense probably damaging 1.00
R7039:Fer1l4 UTSW 2 155,878,650 (GRCm39) missense probably benign 0.05
R7132:Fer1l4 UTSW 2 155,887,546 (GRCm39) missense probably damaging 0.98
R7382:Fer1l4 UTSW 2 155,862,669 (GRCm39) nonsense probably null
R7631:Fer1l4 UTSW 2 155,890,195 (GRCm39) missense probably damaging 1.00
R7693:Fer1l4 UTSW 2 155,862,351 (GRCm39) missense possibly damaging 0.51
R7730:Fer1l4 UTSW 2 155,890,854 (GRCm39) missense probably benign
R8021:Fer1l4 UTSW 2 155,864,511 (GRCm39) missense probably damaging 0.98
R8161:Fer1l4 UTSW 2 155,866,555 (GRCm39) missense probably benign 0.03
R8171:Fer1l4 UTSW 2 155,890,151 (GRCm39) missense probably benign 0.29
R8241:Fer1l4 UTSW 2 155,891,585 (GRCm39) missense probably benign
R8245:Fer1l4 UTSW 2 155,886,934 (GRCm39) critical splice donor site probably null
R8280:Fer1l4 UTSW 2 155,891,620 (GRCm39) missense probably damaging 1.00
R8369:Fer1l4 UTSW 2 155,861,680 (GRCm39) missense probably benign 0.17
R8403:Fer1l4 UTSW 2 155,894,163 (GRCm39) missense possibly damaging 0.88
R8702:Fer1l4 UTSW 2 155,861,310 (GRCm39) missense probably benign 0.00
R8804:Fer1l4 UTSW 2 155,893,914 (GRCm39) missense probably benign 0.28
R8814:Fer1l4 UTSW 2 155,894,163 (GRCm39) missense probably benign 0.04
R8817:Fer1l4 UTSW 2 155,890,143 (GRCm39) missense probably damaging 0.99
R9325:Fer1l4 UTSW 2 155,877,934 (GRCm39) missense probably damaging 1.00
R9342:Fer1l4 UTSW 2 155,877,196 (GRCm39) missense probably benign 0.08
R9527:Fer1l4 UTSW 2 155,871,617 (GRCm39) missense probably damaging 0.96
R9661:Fer1l4 UTSW 2 155,862,336 (GRCm39) missense probably damaging 0.98
RF030:Fer1l4 UTSW 2 155,887,449 (GRCm39) small deletion probably benign
X0063:Fer1l4 UTSW 2 155,876,931 (GRCm39) missense probably damaging 1.00
Z1177:Fer1l4 UTSW 2 155,890,349 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TCAGCCTCTACTTTGGAGCG -3'
(R):5'- CAGCCTCTCTTGGAATCTGAGG -3'

Sequencing Primer
(F):5'- TTCGGAAGCCTCAGTCTCTAG -3'
(R):5'- TCTGAGGACAGAGGGGC -3'
Posted On 2019-05-15