Incidental Mutation 'R7121:Clca3a1'
ID 551987
Institutional Source Beutler Lab
Gene Symbol Clca3a1
Ensembl Gene ENSMUSG00000056025
Gene Name chloride channel accessory 3A1
Synonyms Clca1
MMRRC Submission 045210-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R7121 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 144435438-144466738 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 144717567 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 467 (N467I)
Ref Sequence ENSEMBL: ENSMUSP00000029919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029919]
AlphaFold Q9QX15
Predicted Effect probably damaging
Transcript: ENSMUST00000029919
AA Change: N467I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029919
Gene: ENSMUSG00000028255
AA Change: N467I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 285 297 N/A INTRINSIC
VWA 305 478 5.05e-19 SMART
Blast:FN3 753 852 2e-28 BLAST
Meta Mutation Damage Score 0.2039 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (71/72)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik C T 19: 42,041,112 (GRCm39) A81V probably benign Het
Abcc9 A T 6: 142,634,853 (GRCm39) L137* probably null Het
Akap10 A G 11: 61,777,524 (GRCm39) probably null Het
Alms1 T A 6: 85,601,604 (GRCm39) Y1683N probably damaging Het
Atl1 A G 12: 69,978,408 (GRCm39) S127G probably damaging Het
Cadm1 G A 9: 47,710,708 (GRCm39) V204M probably damaging Het
Cbr3 T A 16: 93,487,438 (GRCm39) I207N probably damaging Het
Ccdc148 A T 2: 58,717,579 (GRCm39) Y475N probably damaging Het
Ccdc33 A T 9: 57,988,167 (GRCm39) S144T probably benign Het
Ceacam5 C A 7: 17,479,462 (GRCm39) A193E probably benign Het
Chd2 T C 7: 73,119,418 (GRCm39) D1042G probably benign Het
Chmp5 A T 4: 40,952,217 (GRCm39) probably null Het
D130040H23Rik T C 8: 69,754,931 (GRCm39) V112A probably damaging Het
Dbh A T 2: 27,058,318 (GRCm39) D162V probably damaging Het
Dnah12 G A 14: 26,500,869 (GRCm39) probably null Het
Dnm2 C T 9: 21,385,862 (GRCm39) T295I probably benign Het
Faiml A C 9: 99,116,446 (GRCm39) D81E probably benign Het
Fer1l4 T A 2: 155,886,477 (GRCm39) Y720F probably benign Het
Fn1 A C 1: 71,639,697 (GRCm39) probably benign Het
Ftsj3 T C 11: 106,143,123 (GRCm39) E397G probably damaging Het
Gm16506 T C 14: 43,964,817 (GRCm39) K42E Het
Gpr179 A G 11: 97,225,556 (GRCm39) S2200P probably benign Het
Gusb T C 5: 130,028,884 (GRCm39) D202G probably benign Het
Hspe1 A G 1: 55,128,310 (GRCm39) E35G probably damaging Het
Kptn T A 7: 15,857,023 (GRCm39) H170Q probably damaging Het
Lama3 G A 18: 12,595,839 (GRCm39) A923T probably benign Het
Lmo7 T A 14: 102,124,471 (GRCm39) I432K probably damaging Het
Maneal G A 4: 124,750,905 (GRCm39) P284S probably benign Het
Mrgbp A G 2: 180,224,682 (GRCm39) T28A probably benign Het
Myo1h T C 5: 114,476,290 (GRCm39) V493A Het
Naxd T C 8: 11,556,745 (GRCm39) L122P probably damaging Het
Neto2 T C 8: 86,397,020 (GRCm39) probably null Het
Obscn T A 11: 58,904,078 (GRCm39) R7299* probably null Het
Odf2l G A 3: 144,845,581 (GRCm39) V363I possibly damaging Het
Or2g25 T C 17: 37,970,699 (GRCm39) H175R probably damaging Het
Or2t35 A G 14: 14,407,998 (GRCm38) T257A possibly damaging Het
Or4c100 A T 2: 88,356,170 (GRCm39) D81V probably damaging Het
Or52a5b A T 7: 103,416,940 (GRCm39) Y221* probably null Het
Or5b105 T A 19: 13,080,537 (GRCm39) I44F probably benign Het
Otud3 G A 4: 138,624,067 (GRCm39) P325L probably benign Het
Palb2 T C 7: 121,724,057 (GRCm39) N564S probably benign Het
Pcnt A G 10: 76,263,761 (GRCm39) V401A possibly damaging Het
Plcd4 G A 1: 74,604,524 (GRCm39) E767K probably benign Het
Ppp3ca T C 3: 136,574,387 (GRCm39) F95S probably damaging Het
Prkar2a A G 9: 108,569,821 (GRCm39) T56A probably benign Het
Psma2 T A 13: 14,799,815 (GRCm39) D186E probably benign Het
Psmd11 T A 11: 80,329,099 (GRCm39) Y72* probably null Het
Ror1 G A 4: 100,160,142 (GRCm39) D53N probably benign Het
Rubcn C T 16: 32,656,839 (GRCm39) R527Q probably damaging Het
Sgca G A 11: 94,860,373 (GRCm39) P255S possibly damaging Het
Skint11 A T 4: 114,084,993 (GRCm39) R167S probably benign Het
Slco5a1 A G 1: 13,060,661 (GRCm39) V20A probably benign Het
Snai2 T C 16: 14,524,970 (GRCm39) S159P probably benign Het
Taar2 T G 10: 23,816,725 (GRCm39) S88R probably damaging Het
Tacc3 T A 5: 33,824,509 (GRCm39) N378K possibly damaging Het
Tek A G 4: 94,699,647 (GRCm39) K342E probably benign Het
Tm9sf3 G T 19: 41,233,944 (GRCm39) S198* probably null Het
Tmbim4 T A 10: 120,051,514 (GRCm39) F56I possibly damaging Het
Tsen34 T A 7: 3,697,986 (GRCm39) S85T probably benign Het
Ttc27 C A 17: 75,054,710 (GRCm39) Q339K probably benign Het
Ubap2 G T 4: 41,205,550 (GRCm39) P636T probably benign Het
Ubr1 G A 2: 120,705,979 (GRCm39) L1495F probably benign Het
Vsig10 T C 5: 117,481,967 (GRCm39) S386P probably damaging Het
Wnk2 C A 13: 49,300,653 (GRCm39) R19L probably benign Het
Wsb2 T C 5: 117,508,944 (GRCm39) L126P probably damaging Het
Xylb A G 9: 119,211,358 (GRCm39) I402V probably benign Het
Yrdc A G 4: 124,744,748 (GRCm39) S61G probably benign Het
Zbtb3 A G 19: 8,780,771 (GRCm39) D128G probably damaging Het
Zfp423 C T 8: 88,507,489 (GRCm39) G952R probably damaging Het
Zfp646 A G 7: 127,478,944 (GRCm39) T374A possibly damaging Het
Other mutations in Clca3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00664:Clca3a1 APN 3 144,733,660 (GRCm39) missense probably benign 0.01
IGL00768:Clca3a1 APN 3 144,461,012 (GRCm39) missense probably damaging 0.96
IGL00862:Clca3a1 APN 3 144,730,332 (GRCm39) missense possibly damaging 0.89
IGL00895:Clca3a1 APN 3 144,730,357 (GRCm39) missense probably damaging 1.00
IGL00969:Clca3a1 APN 3 144,714,719 (GRCm39) missense possibly damaging 0.80
IGL01331:Clca3a1 APN 3 144,453,273 (GRCm39) missense probably damaging 1.00
IGL01398:Clca3a1 APN 3 144,722,512 (GRCm39) missense possibly damaging 0.81
IGL01447:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01455:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01457:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01458:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01462:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01473:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01488:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01490:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01632:Clca3a1 APN 3 144,733,202 (GRCm39) missense probably damaging 1.00
IGL01895:Clca3a1 APN 3 144,453,333 (GRCm39) nonsense probably null
IGL01896:Clca3a1 APN 3 144,721,438 (GRCm39) missense possibly damaging 0.79
IGL01940:Clca3a1 APN 3 144,452,737 (GRCm39) missense probably benign 0.25
IGL02162:Clca3a1 APN 3 144,460,564 (GRCm39) missense probably damaging 0.98
IGL02200:Clca3a1 APN 3 144,457,690 (GRCm39) splice site probably benign
IGL02411:Clca3a1 APN 3 144,733,763 (GRCm39) missense possibly damaging 0.89
IGL03093:Clca3a1 APN 3 144,453,262 (GRCm39) missense probably damaging 0.99
IGL03156:Clca3a1 APN 3 144,719,672 (GRCm39) missense probably damaging 1.00
Lucha UTSW 3 144,455,450 (GRCm39) missense probably damaging 1.00
R0256:Clca3a1 UTSW 3 144,436,640 (GRCm39) missense probably damaging 0.98
R0472:Clca3a1 UTSW 3 144,733,106 (GRCm39) missense probably damaging 1.00
R0513:Clca3a1 UTSW 3 144,466,323 (GRCm39) critical splice donor site probably null
R0543:Clca3a1 UTSW 3 144,454,155 (GRCm39) splice site probably benign
R0571:Clca3a1 UTSW 3 144,713,550 (GRCm39) missense probably damaging 1.00
R0585:Clca3a1 UTSW 3 144,738,386 (GRCm39) missense probably benign 0.16
R0586:Clca3a1 UTSW 3 144,738,350 (GRCm39) missense probably benign 0.45
R0791:Clca3a1 UTSW 3 144,710,615 (GRCm39) missense probably benign 0.01
R1187:Clca3a1 UTSW 3 144,715,504 (GRCm39) missense probably benign 0.30
R1522:Clca3a1 UTSW 3 144,460,932 (GRCm39) missense probably benign 0.01
R1713:Clca3a1 UTSW 3 144,730,307 (GRCm39) missense probably benign 0.00
R1739:Clca3a1 UTSW 3 144,713,539 (GRCm39) missense probably benign 0.00
R1744:Clca3a1 UTSW 3 144,452,596 (GRCm39) missense probably damaging 0.99
R1873:Clca3a1 UTSW 3 144,452,590 (GRCm39) missense probably damaging 0.99
R2079:Clca3a1 UTSW 3 144,713,534 (GRCm39) missense possibly damaging 0.80
R2129:Clca3a1 UTSW 3 144,722,526 (GRCm39) missense probably damaging 1.00
R2178:Clca3a1 UTSW 3 144,711,863 (GRCm39) missense probably damaging 1.00
R2234:Clca3a1 UTSW 3 144,714,829 (GRCm39) missense possibly damaging 0.93
R2235:Clca3a1 UTSW 3 144,714,829 (GRCm39) missense possibly damaging 0.93
R2238:Clca3a1 UTSW 3 144,457,766 (GRCm39) missense possibly damaging 0.94
R2240:Clca3a1 UTSW 3 144,714,746 (GRCm39) missense probably damaging 1.00
R2278:Clca3a1 UTSW 3 144,463,785 (GRCm39) missense probably damaging 0.99
R2516:Clca3a1 UTSW 3 144,443,619 (GRCm39) splice site probably null
R3737:Clca3a1 UTSW 3 144,436,482 (GRCm39) missense probably benign 0.01
R3751:Clca3a1 UTSW 3 144,724,424 (GRCm39) missense probably benign 0.01
R3974:Clca3a1 UTSW 3 144,738,400 (GRCm39) missense probably damaging 1.00
R3975:Clca3a1 UTSW 3 144,738,400 (GRCm39) missense probably damaging 1.00
R3981:Clca3a1 UTSW 3 144,461,070 (GRCm39) missense probably benign 0.00
R3982:Clca3a1 UTSW 3 144,461,070 (GRCm39) missense probably benign 0.00
R3983:Clca3a1 UTSW 3 144,461,070 (GRCm39) missense probably benign 0.00
R4038:Clca3a1 UTSW 3 144,460,994 (GRCm39) missense probably benign 0.35
R4382:Clca3a1 UTSW 3 144,466,483 (GRCm39) start codon destroyed probably benign 0.08
R4409:Clca3a1 UTSW 3 144,711,788 (GRCm39) missense probably damaging 1.00
R4543:Clca3a1 UTSW 3 144,452,749 (GRCm39) missense probably damaging 1.00
R4586:Clca3a1 UTSW 3 144,722,619 (GRCm39) missense probably damaging 1.00
R4751:Clca3a1 UTSW 3 144,710,609 (GRCm39) missense possibly damaging 0.89
R4766:Clca3a1 UTSW 3 144,455,473 (GRCm39) missense probably damaging 1.00
R4894:Clca3a1 UTSW 3 144,719,662 (GRCm39) missense probably damaging 0.99
R4899:Clca3a1 UTSW 3 144,443,722 (GRCm39) missense probably damaging 1.00
R4909:Clca3a1 UTSW 3 144,730,324 (GRCm39) missense probably damaging 1.00
R4916:Clca3a1 UTSW 3 144,721,605 (GRCm39) missense probably benign 0.01
R4941:Clca3a1 UTSW 3 144,721,414 (GRCm39) missense probably damaging 1.00
R4942:Clca3a1 UTSW 3 144,710,524 (GRCm39) missense probably benign 0.02
R5044:Clca3a1 UTSW 3 144,713,689 (GRCm39) splice site probably null
R5090:Clca3a1 UTSW 3 144,443,633 (GRCm39) missense probably benign 0.01
R5091:Clca3a1 UTSW 3 144,436,483 (GRCm39) missense probably benign 0.00
R5205:Clca3a1 UTSW 3 144,452,545 (GRCm39) missense possibly damaging 0.68
R5248:Clca3a1 UTSW 3 144,442,897 (GRCm39) missense possibly damaging 0.62
R5354:Clca3a1 UTSW 3 144,442,766 (GRCm39) missense possibly damaging 0.77
R5451:Clca3a1 UTSW 3 144,733,747 (GRCm39) missense probably damaging 1.00
R5618:Clca3a1 UTSW 3 144,710,738 (GRCm39) missense probably benign 0.00
R5724:Clca3a1 UTSW 3 144,714,833 (GRCm39) missense probably benign 0.01
R5871:Clca3a1 UTSW 3 144,460,642 (GRCm39) missense probably damaging 1.00
R5898:Clca3a1 UTSW 3 144,722,522 (GRCm39) missense possibly damaging 0.89
R5907:Clca3a1 UTSW 3 144,455,403 (GRCm39) intron probably benign
R5976:Clca3a1 UTSW 3 144,452,636 (GRCm39) missense probably damaging 1.00
R6190:Clca3a1 UTSW 3 144,463,821 (GRCm39) missense probably benign 0.40
R6193:Clca3a1 UTSW 3 144,464,993 (GRCm39) missense possibly damaging 0.65
R6238:Clca3a1 UTSW 3 144,714,716 (GRCm39) missense probably benign 0.09
R6263:Clca3a1 UTSW 3 144,455,539 (GRCm39) missense probably damaging 1.00
R6299:Clca3a1 UTSW 3 144,464,275 (GRCm39) missense probably damaging 0.99
R6327:Clca3a1 UTSW 3 144,436,558 (GRCm39) missense probably benign 0.02
R6497:Clca3a1 UTSW 3 144,465,020 (GRCm39) missense possibly damaging 0.81
R6542:Clca3a1 UTSW 3 144,465,021 (GRCm39) missense probably benign 0.01
R6547:Clca3a1 UTSW 3 144,442,708 (GRCm39) missense probably damaging 1.00
R6590:Clca3a1 UTSW 3 144,719,644 (GRCm39) missense probably damaging 1.00
R6591:Clca3a1 UTSW 3 144,719,644 (GRCm39) missense probably damaging 1.00
R6592:Clca3a1 UTSW 3 144,719,644 (GRCm39) missense probably damaging 1.00
R6690:Clca3a1 UTSW 3 144,719,644 (GRCm39) missense probably damaging 1.00
R6691:Clca3a1 UTSW 3 144,719,644 (GRCm39) missense probably damaging 1.00
R6729:Clca3a1 UTSW 3 144,711,727 (GRCm39) missense probably damaging 1.00
R6759:Clca3a1 UTSW 3 144,455,450 (GRCm39) missense probably damaging 1.00
R6805:Clca3a1 UTSW 3 144,724,428 (GRCm39) missense probably damaging 1.00
R7032:Clca3a1 UTSW 3 144,453,329 (GRCm39) missense probably benign 0.07
R7063:Clca3a1 UTSW 3 144,460,967 (GRCm39) missense probably damaging 0.97
R7106:Clca3a1 UTSW 3 144,733,190 (GRCm39) missense probably damaging 0.98
R7127:Clca3a1 UTSW 3 144,711,806 (GRCm39) missense probably damaging 1.00
R7139:Clca3a1 UTSW 3 144,461,063 (GRCm39) missense possibly damaging 0.58
R7212:Clca3a1 UTSW 3 144,711,727 (GRCm39) missense probably damaging 1.00
R7444:Clca3a1 UTSW 3 144,733,193 (GRCm39) missense probably damaging 1.00
R7446:Clca3a1 UTSW 3 144,733,188 (GRCm39) missense possibly damaging 0.65
R7535:Clca3a1 UTSW 3 144,724,328 (GRCm39) missense probably damaging 0.99
R7638:Clca3a1 UTSW 3 144,457,723 (GRCm39) missense probably damaging 1.00
R7663:Clca3a1 UTSW 3 144,442,797 (GRCm39) missense probably benign 0.02
R7792:Clca3a1 UTSW 3 144,455,492 (GRCm39) missense possibly damaging 0.95
R7798:Clca3a1 UTSW 3 144,463,723 (GRCm39) missense probably damaging 1.00
R7892:Clca3a1 UTSW 3 144,436,579 (GRCm39) missense probably benign 0.00
R8096:Clca3a1 UTSW 3 144,455,446 (GRCm39) missense probably damaging 1.00
R8305:Clca3a1 UTSW 3 144,464,927 (GRCm39) splice site probably benign
R8416:Clca3a1 UTSW 3 144,460,914 (GRCm39) critical splice donor site probably null
R8437:Clca3a1 UTSW 3 144,710,822 (GRCm39) missense probably benign 0.00
R8446:Clca3a1 UTSW 3 144,454,248 (GRCm39) missense probably damaging 0.97
R8474:Clca3a1 UTSW 3 144,710,792 (GRCm39) missense possibly damaging 0.77
R8496:Clca3a1 UTSW 3 144,453,182 (GRCm39) makesense probably null
R8766:Clca3a1 UTSW 3 144,714,939 (GRCm39) splice site probably benign
R8884:Clca3a1 UTSW 3 144,719,757 (GRCm39) missense probably benign 0.35
R9014:Clca3a1 UTSW 3 144,442,731 (GRCm39) missense probably benign 0.01
R9049:Clca3a1 UTSW 3 144,733,143 (GRCm39) missense probably benign 0.01
R9128:Clca3a1 UTSW 3 144,463,795 (GRCm39) missense probably damaging 1.00
R9306:Clca3a1 UTSW 3 144,730,339 (GRCm39) missense probably damaging 1.00
R9601:Clca3a1 UTSW 3 144,453,310 (GRCm39) missense probably benign 0.27
R9623:Clca3a1 UTSW 3 144,719,698 (GRCm39) missense probably benign 0.03
X0020:Clca3a1 UTSW 3 144,738,421 (GRCm39) missense possibly damaging 0.89
Z1088:Clca3a1 UTSW 3 144,452,714 (GRCm39) missense probably damaging 1.00
Z1176:Clca3a1 UTSW 3 144,719,682 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAAGCTGAAGACTGGGATTTTC -3'
(R):5'- ACGTAGCTTCGTGATGGATAC -3'

Sequencing Primer
(F):5'- AGACTGGGATTTTCAATTAATACCC -3'
(R):5'- CGTGATGGATACTTCTGAAGCTATTC -3'
Posted On 2019-05-15