Incidental Mutation 'R0599:Abcb1a'
ID 55202
Institutional Source Beutler Lab
Gene Symbol Abcb1a
Ensembl Gene ENSMUSG00000040584
Gene Name ATP-binding cassette, sub-family B (MDR/TAP), member 1A
Synonyms Pgp, mdr-3, Pgy-3, MDR3, P-glycoprotein, Evi32, P-gp, Mdr1a, Pgy3, multiple drug resistant 1a
MMRRC Submission 038788-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.141) question?
Stock # R0599 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 8660077-8748575 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 8698539 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 290 (T290M)
Ref Sequence ENSEMBL: ENSMUSP00000041204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047753]
AlphaFold P21447
PDB Structure Structure of P-glycoprotein Reveals a Molecular Basis for Poly-Specific Drug Binding [X-RAY DIFFRACTION]
Structure of P-glycoprotein Reveals a Molecular Basis for Poly-Specific Drug Binding [X-RAY DIFFRACTION]
Structure of P-glycoprotein Reveals a Molecular Basis for Poly-Specific Drug Binding [X-RAY DIFFRACTION]
Structures of P-glycoprotein reveal its conformational flexibility and an epitope on the nucleotide-binding domain [X-RAY DIFFRACTION]
Structures of P-glycoprotein reveal its conformational flexibility and an epitope on the nucleotide-binding domain [X-RAY DIFFRACTION]
Structures of P-glycoprotein reveal its conformational flexibility and an epitope on the nucleotide-binding domain [X-RAY DIFFRACTION]
Structure of Mouse P-Glycoprotein [X-RAY DIFFRACTION]
Corrected Structure of Mouse P-glycoprotein [X-RAY DIFFRACTION]
Corrected Structure of Mouse P-glycoprotein bound to QZ59-RRR [X-RAY DIFFRACTION]
Corrected Structure of Mouse P-glycoprotein bound to QZ59-SSS [X-RAY DIFFRACTION]
>> 5 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000047753
AA Change: T290M

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000041204
Gene: ENSMUSG00000040584
AA Change: T290M

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
Pfam:ABC_membrane 50 339 8.3e-97 PFAM
AAA 415 607 1.22e-20 SMART
Pfam:ABC_membrane 707 982 4.8e-79 PFAM
AAA 1058 1246 8.85e-18 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This gene encodes a p-glycoprotein which actively transports a variety of hydrophobic amphipathic drugs and plays a major role in the blood-brain barrier permeability of certain drugs. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in increased sensitivity to various drugs, including avermectins and vinblastine. Mice with a null allele develop spontanous colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,552,245 L978P probably damaging Het
Abcd3 A T 3: 121,765,093 F585I probably damaging Het
Acan A G 7: 79,111,290 probably benign Het
Anxa6 T C 11: 54,979,466 D667G possibly damaging Het
Ap3m2 G T 8: 22,793,112 A208D possibly damaging Het
Arhgap17 A T 7: 123,303,790 probably benign Het
Bptf A G 11: 107,068,382 V1838A probably damaging Het
Brip1 T A 11: 86,152,737 M334L probably benign Het
Btbd10 C T 7: 113,335,309 probably benign Het
Btbd11 G A 10: 85,658,336 G1106D probably damaging Het
Cdh7 C A 1: 110,052,966 T208K probably damaging Het
Cnga4 A G 7: 105,405,818 Y100C probably damaging Het
Dnah10 G A 5: 124,800,953 V2644M probably damaging Het
Dnah9 T C 11: 65,965,689 D2882G probably damaging Het
Eapp T A 12: 54,685,962 K117M probably damaging Het
Eml3 T C 19: 8,939,063 V673A probably benign Het
Ephb4 G A 5: 137,369,855 C754Y probably damaging Het
Eps8l1 A G 7: 4,477,957 D33G possibly damaging Het
Farsa A G 8: 84,867,583 K321E probably damaging Het
Fry G A 5: 150,437,159 R2090Q probably damaging Het
Gm10283 A G 8: 60,501,224 probably benign Het
Grm4 A G 17: 27,431,490 I844T probably benign Het
Gtf2h3 A G 5: 124,588,628 D124G probably benign Het
Gulo A T 14: 65,990,441 D347E probably damaging Het
Hmcn1 A G 1: 150,609,801 F4350S possibly damaging Het
Hspg2 A G 4: 137,512,401 D473G probably damaging Het
Il17ra T A 6: 120,481,505 I539N probably damaging Het
Insrr A G 3: 87,813,133 E1026G probably damaging Het
Itga2 A T 13: 114,856,650 probably benign Het
Kdm1b A T 13: 47,058,810 D190V possibly damaging Het
Lima1 A T 15: 99,802,159 N146K probably damaging Het
Mettl7a3 A T 15: 100,335,383 N152Y possibly damaging Het
Mnt G T 11: 74,842,296 V85L probably benign Het
Mon2 T A 10: 123,026,065 probably benign Het
Mtf1 T C 4: 124,820,201 probably benign Het
Mylk4 T C 13: 32,712,754 probably null Het
Myo18b A C 5: 112,865,750 L780R probably damaging Het
Myo1e A G 9: 70,376,660 probably benign Het
Obscn A G 11: 59,073,696 S705P probably damaging Het
Ocrl A T X: 47,936,086 probably benign Het
Olfr1260 T C 2: 89,978,201 F141S probably benign Het
Olfr394 A T 11: 73,887,904 M156K probably benign Het
Olfr599 A G 7: 103,338,186 N44S probably damaging Het
Olfr639 A T 7: 104,012,188 C171* probably null Het
Otof T A 5: 30,370,705 K1931N probably damaging Het
Plcxd3 A G 15: 4,516,867 S118G probably damaging Het
Plcz1 T A 6: 140,028,542 Q58L probably benign Het
Proser1 C A 3: 53,479,064 P789Q probably benign Het
Rassf4 T C 6: 116,645,936 E38G probably damaging Het
Ros1 A T 10: 52,123,300 Y1164N probably damaging Het
Rpgrip1l A G 8: 91,305,000 I83T probably damaging Het
Scn9a T G 2: 66,526,799 K1053Q probably damaging Het
Sgsm1 G T 5: 113,245,028 Q1087K probably damaging Het
Slc16a10 T C 10: 40,141,918 D40G probably benign Het
Slc27a6 A G 18: 58,556,813 D117G probably damaging Het
Slc2a9 T A 5: 38,480,144 probably benign Het
Slc4a1 A G 11: 102,357,915 probably benign Het
Smarca1 T A X: 47,823,426 Q982L probably benign Het
Sp100 T A 1: 85,681,110 I320N possibly damaging Het
Stx8 A T 11: 68,109,362 R209S probably null Het
Sulf2 T C 2: 166,083,879 T453A possibly damaging Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tenm2 T A 11: 36,024,780 I1976F possibly damaging Het
Tenm3 G A 8: 48,277,710 S1341L probably damaging Het
Tmem130 C T 5: 144,737,809 V369M probably damaging Het
Tmem200c A G 17: 68,840,511 K30E probably damaging Het
Tmem225 A G 9: 40,149,747 I117V possibly damaging Het
Top2a A G 11: 99,001,417 I1073T probably damaging Het
Trps1 A C 15: 50,831,860 Y296* probably null Het
Tubg1 T C 11: 101,125,336 M377T probably benign Het
Vmn1r35 G A 6: 66,679,513 H58Y probably benign Het
Vmn1r56 G A 7: 5,196,430 H63Y probably benign Het
Vmn1r75 T C 7: 11,881,262 probably null Het
Vnn3 T C 10: 23,865,705 S303P possibly damaging Het
Wdr49 C T 3: 75,431,076 probably null Het
Wdr49 T C 3: 75,449,890 probably null Het
Zcchc6 A G 13: 59,809,487 V7A probably damaging Het
Zzef1 T C 11: 72,913,178 L2582P probably damaging Het
Other mutations in Abcb1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Abcb1a APN 5 8686257 missense probably benign 0.01
IGL00898:Abcb1a APN 5 8733690 missense probably damaging 0.97
IGL01064:Abcb1a APN 5 8732388 missense possibly damaging 0.65
IGL01118:Abcb1a APN 5 8674687 missense probably damaging 1.00
IGL01150:Abcb1a APN 5 8702550 missense possibly damaging 0.90
IGL01584:Abcb1a APN 5 8698637 missense possibly damaging 0.95
IGL01654:Abcb1a APN 5 8715065 critical splice donor site probably null
IGL01820:Abcb1a APN 5 8715896 splice site probably benign
IGL02499:Abcb1a APN 5 8726807 missense possibly damaging 0.67
IGL02711:Abcb1a APN 5 8723245 splice site probably null
IGL02954:Abcb1a APN 5 8732341 missense probably benign 0.00
IGL03018:Abcb1a APN 5 8702451 missense probably damaging 0.99
IGL03119:Abcb1a APN 5 8714887 missense probably benign 0.00
IGL03292:Abcb1a APN 5 8715827 missense possibly damaging 0.93
IGL03338:Abcb1a APN 5 8694153 missense probably damaging 1.00
R0418:Abcb1a UTSW 5 8713281 missense probably damaging 0.96
R0559:Abcb1a UTSW 5 8698535 missense probably benign 0.01
R0595:Abcb1a UTSW 5 8740417 missense probably damaging 1.00
R0811:Abcb1a UTSW 5 8713229 missense probably damaging 1.00
R0812:Abcb1a UTSW 5 8713229 missense probably damaging 1.00
R0894:Abcb1a UTSW 5 8674856 splice site probably benign
R0948:Abcb1a UTSW 5 8740621 splice site probably null
R1292:Abcb1a UTSW 5 8713343 missense probably benign 0.00
R1318:Abcb1a UTSW 5 8701621 missense probably benign 0.31
R1459:Abcb1a UTSW 5 8702920 missense probably damaging 1.00
R1489:Abcb1a UTSW 5 8686300 critical splice donor site probably null
R1514:Abcb1a UTSW 5 8674791 missense possibly damaging 0.88
R2100:Abcb1a UTSW 5 8713202 missense probably damaging 1.00
R2409:Abcb1a UTSW 5 8738747 missense probably benign 0.30
R2844:Abcb1a UTSW 5 8686164 missense probably benign 0.02
R3709:Abcb1a UTSW 5 8738738 missense probably benign 0.03
R3755:Abcb1a UTSW 5 8747403 missense possibly damaging 0.95
R4193:Abcb1a UTSW 5 8715068 splice site probably null
R4401:Abcb1a UTSW 5 8702390 missense possibly damaging 0.54
R4463:Abcb1a UTSW 5 8719981 splice site probably benign
R4539:Abcb1a UTSW 5 8715793 missense probably benign
R4635:Abcb1a UTSW 5 8714927 missense probably benign
R4740:Abcb1a UTSW 5 8702280 critical splice donor site probably null
R4757:Abcb1a UTSW 5 8737632 missense probably damaging 0.99
R4764:Abcb1a UTSW 5 8715732 splice site probably null
R4792:Abcb1a UTSW 5 8746657 critical splice donor site probably null
R4829:Abcb1a UTSW 5 8723214 missense probably damaging 1.00
R4935:Abcb1a UTSW 5 8737773 critical splice donor site probably null
R5140:Abcb1a UTSW 5 8702154 missense probably damaging 0.99
R5181:Abcb1a UTSW 5 8714937 missense probably benign
R5355:Abcb1a UTSW 5 8726873 missense probably damaging 1.00
R5406:Abcb1a UTSW 5 8702946 missense probably damaging 0.99
R5496:Abcb1a UTSW 5 8674818 missense probably benign
R5557:Abcb1a UTSW 5 8714949 missense probably benign 0.01
R5572:Abcb1a UTSW 5 8715108 splice site probably null
R5702:Abcb1a UTSW 5 8737752 missense probably benign 0.15
R5753:Abcb1a UTSW 5 8723160 missense probably damaging 0.98
R5769:Abcb1a UTSW 5 8683426 missense probably benign 0.01
R5895:Abcb1a UTSW 5 8702216 missense probably damaging 1.00
R6536:Abcb1a UTSW 5 8719030 missense probably benign 0.01
R6555:Abcb1a UTSW 5 8702468 missense probably damaging 0.97
R6798:Abcb1a UTSW 5 8732364 missense probably damaging 1.00
R6875:Abcb1a UTSW 5 8701628 missense probably benign 0.28
R7000:Abcb1a UTSW 5 8702823 missense probably benign 0.19
R7102:Abcb1a UTSW 5 8694072 missense probably benign 0.01
R7172:Abcb1a UTSW 5 8702399 missense probably benign 0.00
R7313:Abcb1a UTSW 5 8723187 missense probably damaging 1.00
R7513:Abcb1a UTSW 5 8715771 nonsense probably null
R7718:Abcb1a UTSW 5 8715788 missense probably damaging 1.00
R7816:Abcb1a UTSW 5 8686132 missense possibly damaging 0.56
R7829:Abcb1a UTSW 5 8698623 missense probably benign 0.06
R7943:Abcb1a UTSW 5 8686222 missense probably benign
R8040:Abcb1a UTSW 5 8715035 missense probably benign 0.00
R8086:Abcb1a UTSW 5 8674833 missense probably benign
R8271:Abcb1a UTSW 5 8686212 missense probably benign 0.41
R8367:Abcb1a UTSW 5 8686221 missense probably benign 0.00
R8520:Abcb1a UTSW 5 8685346 missense possibly damaging 0.67
R8680:Abcb1a UTSW 5 8685371 missense probably damaging 0.99
R8820:Abcb1a UTSW 5 8723204 missense possibly damaging 0.69
R8996:Abcb1a UTSW 5 8719069 missense probably benign 0.00
R9114:Abcb1a UTSW 5 8738702 nonsense probably null
R9127:Abcb1a UTSW 5 8674707 missense probably benign
R9187:Abcb1a UTSW 5 8715016 missense probably benign
R9294:Abcb1a UTSW 5 8686171 missense probably benign 0.02
R9459:Abcb1a UTSW 5 8685414 critical splice donor site probably null
R9581:Abcb1a UTSW 5 8740428 missense possibly damaging 0.66
R9617:Abcb1a UTSW 5 8747353 critical splice acceptor site probably null
R9676:Abcb1a UTSW 5 8664548 missense possibly damaging 0.87
R9682:Abcb1a UTSW 5 8702507 missense probably benign 0.44
R9790:Abcb1a UTSW 5 8698604 missense probably damaging 1.00
R9791:Abcb1a UTSW 5 8698604 missense probably damaging 1.00
Z1177:Abcb1a UTSW 5 8746544 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCTCACTGATTTCACTATTGCTAGGC -3'
(R):5'- GGGATCTGGAACTCCTGATGGAAATG -3'

Sequencing Primer
(F):5'- AGGCTTACACACAAAGAACATTTAG -3'
(R):5'- CTCCTGATGGAAATGATGGTATTGC -3'
Posted On 2013-07-11