Incidental Mutation 'R7121:Akap10'
ID552024
Institutional Source Beutler Lab
Gene Symbol Akap10
Ensembl Gene ENSMUSG00000047804
Gene NameA kinase (PRKA) anchor protein 10
SynonymsB130049N18Rik, 1500031L16Rik, D-AKAP2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.747) question?
Stock #R7121 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location61871307-61930252 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 61886698 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058173] [ENSMUST00000102650]
Predicted Effect probably benign
Transcript: ENSMUST00000058173
SMART Domains Protein: ENSMUSP00000054418
Gene: ENSMUSG00000047804

DomainStartEndE-ValueType
RGS 46 290 1.82e-30 SMART
RGS 300 426 9.62e-30 SMART
Predicted Effect probably null
Transcript: ENSMUST00000102650
SMART Domains Protein: ENSMUSP00000099710
Gene: ENSMUSG00000047804

DomainStartEndE-ValueType
RGS 125 369 1.82e-30 SMART
RGS 379 505 9.62e-30 SMART
PDB:3TMH|L 623 662 2e-18 PDB
Blast:S_TKc 636 661 1e-5 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: This gene encodes a member of A-kinase anchoring proteins (AKAPs), a family of functionally related proteins that target protein kinase A to discrete locations within the cell. The encoded protein is localized to mitochondria and interacts with both the type I and type II regulatory subunits of PKA. It has been reported that this protein is important for maintaining heart rate and myocardial contractility through its targeting of protein kinase A. In mouse, defects of this gene lead to cardiac arrhythmias and premature death. In humans, polymorphisms in this gene may be associated with increased risk of arrhythmias and sudden cardiac death. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a gene trapped allele display sinus arrhythmia, sinus pauses, and atrioventricular heart block indicating excessive vagus nerve sensitivity; about 50% of homozygous and 25% of heterozygous mutant mice die in the first year of life, and survival is sensitive to genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik C T 19: 42,052,673 A81V probably benign Het
Abcc9 A T 6: 142,689,127 L137* probably null Het
Alms1 T A 6: 85,624,622 Y1683N probably damaging Het
Atl1 A G 12: 69,931,634 S127G probably damaging Het
Cadm1 G A 9: 47,799,410 V204M probably damaging Het
Cbr3 T A 16: 93,690,550 I207N probably damaging Het
Ccdc148 A T 2: 58,827,567 Y475N probably damaging Het
Ccdc33 A T 9: 58,080,884 S144T probably benign Het
Ceacam5 C A 7: 17,745,537 A193E probably benign Het
Chd2 T C 7: 73,469,670 D1042G probably benign Het
Chmp5 A T 4: 40,952,217 probably null Het
Clca1 T A 3: 145,011,806 N467I probably damaging Het
D130040H23Rik T C 8: 69,302,279 V112A probably damaging Het
Dbh A T 2: 27,168,306 D162V probably damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dnm2 C T 9: 21,474,566 T295I probably benign Het
Faiml A C 9: 99,234,393 D81E probably benign Het
Fer1l4 T A 2: 156,044,557 Y720F probably benign Het
Fn1 A C 1: 71,600,538 probably benign Het
Ftsj3 T C 11: 106,252,297 E397G probably damaging Het
Gm16506 T C 14: 43,727,360 K42E Het
Gpr179 A G 11: 97,334,730 S2200P probably benign Het
Gusb T C 5: 130,000,043 D202G probably benign Het
Hspe1 A G 1: 55,089,151 E35G probably damaging Het
Kptn T A 7: 16,123,098 H170Q probably damaging Het
Lama3 G A 18: 12,462,782 A923T probably benign Het
Lmo7 T A 14: 101,887,035 I432K probably damaging Het
Maneal G A 4: 124,857,112 P284S probably benign Het
Mrgbp A G 2: 180,582,889 T28A probably benign Het
Myo1h T C 5: 114,338,229 V493A Het
Naxd T C 8: 11,506,745 L122P probably damaging Het
Neto2 T C 8: 85,670,391 probably null Het
Obscn T A 11: 59,013,252 R7299* probably null Het
Odf2l G A 3: 145,139,820 V363I possibly damaging Het
Olfr117 T C 17: 37,659,808 H175R probably damaging Het
Olfr1186 A T 2: 88,525,826 D81V probably damaging Het
Olfr1458 T A 19: 13,103,173 I44F probably benign Het
Olfr69 A T 7: 103,767,733 Y221* probably null Het
Olfr721-ps1 A G 14: 14,407,998 T257A possibly damaging Het
Otud3 G A 4: 138,896,756 P325L probably benign Het
Palb2 T C 7: 122,124,834 N564S probably benign Het
Pcnt A G 10: 76,427,927 V401A possibly damaging Het
Plcd4 G A 1: 74,565,365 E767K probably benign Het
Ppp3ca T C 3: 136,868,626 F95S probably damaging Het
Prkar2a A G 9: 108,692,622 T56A probably benign Het
Psma2 T A 13: 14,625,230 D186E probably benign Het
Psmd11 T A 11: 80,438,273 Y72* probably null Het
Ror1 G A 4: 100,302,945 D53N probably benign Het
Rubcn C T 16: 32,836,469 R527Q probably damaging Het
Sgca G A 11: 94,969,547 P255S possibly damaging Het
Skint11 A T 4: 114,227,796 R167S probably benign Het
Slco5a1 A G 1: 12,990,437 V20A probably benign Het
Snai2 T C 16: 14,707,106 S159P probably benign Het
Taar2 T G 10: 23,940,827 S88R probably damaging Het
Tacc3 T A 5: 33,667,165 N378K possibly damaging Het
Tek A G 4: 94,811,410 K342E probably benign Het
Tm9sf3 G T 19: 41,245,505 S198* probably null Het
Tmbim4 T A 10: 120,215,609 F56I possibly damaging Het
Tsen34 T A 7: 3,694,987 S85T probably benign Het
Ttc27 C A 17: 74,747,715 Q339K probably benign Het
Ubap2 G T 4: 41,205,550 P636T probably benign Het
Ubr1 G A 2: 120,875,498 L1495F probably benign Het
Vsig10 T C 5: 117,343,902 S386P probably damaging Het
Wnk2 C A 13: 49,147,177 R19L probably benign Het
Wsb2 T C 5: 117,370,879 L126P probably damaging Het
Xylb A G 9: 119,382,292 I402V probably benign Het
Yrdc A G 4: 124,850,955 S61G probably benign Het
Zbtb3 A G 19: 8,803,407 D128G probably damaging Het
Zfp423 C T 8: 87,780,861 G952R probably damaging Het
Zfp646 A G 7: 127,879,772 T374A possibly damaging Het
Other mutations in Akap10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Akap10 APN 11 61915071 missense possibly damaging 0.85
IGL00971:Akap10 APN 11 61904796 missense possibly damaging 0.68
IGL01510:Akap10 APN 11 61878020 missense possibly damaging 0.74
IGL02731:Akap10 APN 11 61893476 missense possibly damaging 0.78
IGL03289:Akap10 APN 11 61877968 splice site probably benign
IGL03294:Akap10 APN 11 61877353 missense probably damaging 1.00
IGL03403:Akap10 APN 11 61915273 missense probably benign 0.00
P4748:Akap10 UTSW 11 61873020 missense possibly damaging 0.86
R0924:Akap10 UTSW 11 61904863 splice site probably benign
R1324:Akap10 UTSW 11 61915021 splice site probably null
R2117:Akap10 UTSW 11 61890303 missense possibly damaging 0.73
R2243:Akap10 UTSW 11 61915501 missense possibly damaging 0.56
R2402:Akap10 UTSW 11 61915222 missense probably benign
R2567:Akap10 UTSW 11 61893349 intron probably benign
R3745:Akap10 UTSW 11 61915305 missense probably benign
R5124:Akap10 UTSW 11 61916189 missense probably damaging 1.00
R5126:Akap10 UTSW 11 61916189 missense probably damaging 1.00
R5180:Akap10 UTSW 11 61916189 missense probably damaging 1.00
R5219:Akap10 UTSW 11 61922791 missense probably benign
R5324:Akap10 UTSW 11 61916189 missense probably damaging 1.00
R6753:Akap10 UTSW 11 61886777 missense probably damaging 0.96
R7763:Akap10 UTSW 11 61915505 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACCGGGATTCTACTACTGCTG -3'
(R):5'- AATATGAGCTGTGGTTCCAGC -3'

Sequencing Primer
(F):5'- GCTGTGCTTTCTATAGTGGCAATAAC -3'
(R):5'- CCAGCTTTTGAGCTTTTGGTAAG -3'
Posted On2019-05-15