Mutagenetix > Incidental Mutation

Incidental Mutation 'R0599:Otof'

55203

Institutional Source

Beutler Lab

Gene Symbol

Otof

Ensembl Gene

ENSMUSG00000062372

Gene Name

otoferlin

Synonyms

MMRRC Submission

038788-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.121) question?

Stock #

R0599 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30367062-30461932 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 30370705 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 1931 (K1931N)

Ref Sequence

ENSEMBL: ENSMUSP00000110395 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074171] [ENSMUST00000101448] [ENSMUST00000114747]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000074171
AA Change: K1936N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000073803
Gene: ENSMUSG00000062372
AA Change: K1936N

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	254	352	3.76e-11	SMART
FerI	338	409	7.91e-38	SMART
C2	417	528	1.75e-11	SMART
low complexity region	607	618	N/A	INTRINSIC
FerB	841	917	5.13e-46	SMART
C2	960	1067	1.77e-7	SMART
low complexity region	1191	1202	N/A	INTRINSIC
low complexity region	1265	1276	N/A	INTRINSIC
low complexity region	1293	1323	N/A	INTRINSIC
low complexity region	1370	1385	N/A	INTRINSIC
low complexity region	1436	1447	N/A	INTRINSIC
C2	1493	1592	6.54e-11	SMART
C2	1733	1863	4.02e0	SMART
Pfam:Ferlin_C	1895	1994	7.2e-33	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000101448

SMART Domains

Protein: ENSMUSP00000098992
Gene: ENSMUSG00000073102

Domain	Start	End	E-Value	Type
low complexity region	33	55	N/A	INTRINSIC
low complexity region	62	79	N/A	INTRINSIC
Pfam:NYD-SP28	100	200	1.7e-33	PFAM
coiled coil region	280	318	N/A	INTRINSIC
low complexity region	455	473	N/A	INTRINSIC
low complexity region	559	569	N/A	INTRINSIC
low complexity region	599	612	N/A	INTRINSIC
Pfam:NYD-SP28_assoc	673	732	2.2e-25	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000114747
AA Change: K1931N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110395
Gene: ENSMUSG00000062372
AA Change: K1931N

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	269	367	3.76e-11	SMART
FerI	353	424	7.91e-38	SMART
C2	432	543	1.75e-11	SMART
low complexity region	622	633	N/A	INTRINSIC
FerB	856	932	5.13e-46	SMART
C2	975	1082	1.77e-7	SMART
Pfam:C2	1153	1236	1.8e-1	PFAM
low complexity region	1260	1271	N/A	INTRINSIC
low complexity region	1288	1318	N/A	INTRINSIC
low complexity region	1365	1380	N/A	INTRINSIC
low complexity region	1431	1442	N/A	INTRINSIC
C2	1488	1587	6.54e-11	SMART
C2	1728	1858	4.02e0	SMART
low complexity region	1903	1915	N/A	INTRINSIC
transmembrane domain	1959	1981	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144125

SMART Domains

Protein: ENSMUSP00000120679
Gene: ENSMUSG00000062372

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	254	352	3.76e-11	SMART
FerI	338	409	7.91e-38	SMART
C2	417	528	1.75e-11	SMART
low complexity region	607	618	N/A	INTRINSIC
FerB	841	917	5.13e-46	SMART
C2	960	1067	1.77e-7	SMART
low complexity region	1191	1202	N/A	INTRINSIC
low complexity region	1265	1276	N/A	INTRINSIC
low complexity region	1293	1323	N/A	INTRINSIC
low complexity region	1370	1385	N/A	INTRINSIC
low complexity region	1436	1447	N/A	INTRINSIC
C2	1493	1592	6.54e-11	SMART
C2	1733	1863	4.02e0	SMART
Pfam:Ferlin_C	1895	1994	7.2e-33	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150734

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200001

Meta Mutation Damage Score

0.2212

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.5%
20x: 95.0%

Validation Efficiency

98% (80/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are a cause of neurosensory nonsyndromic recessive deafness, DFNB9. The short form of the encoded protein has 3 C2 domains, a single carboxy-terminal transmembrane domain found also in the C. elegans spermatogenesis factor FER-1 and human dysferlin, while the long form has 6 C2 domains. The homology suggests that this protein may be involved in vesicle membrane fusion. Several transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants have no detectable auditory brainstem response at any frequency tested. Otoacoustic transmission distortion products are detected. Direct electrical stimulation of cochlear ganglia elicits brainstem responses. On depolarization, inner hair cells release almost no neurotransmitter. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	A	G	6: 128,552,245	L978P	probably damaging	Het
Abcb1a	C	T	5: 8,698,539	T290M	probably benign	Het
Abcd3	A	T	3: 121,765,093	F585I	probably damaging	Het
Acan	A	G	7: 79,111,290		probably benign	Het
Anxa6	T	C	11: 54,979,466	D667G	possibly damaging	Het
Ap3m2	G	T	8: 22,793,112	A208D	possibly damaging	Het
Arhgap17	A	T	7: 123,303,790		probably benign	Het
Bptf	A	G	11: 107,068,382	V1838A	probably damaging	Het
Brip1	T	A	11: 86,152,737	M334L	probably benign	Het
Btbd10	C	T	7: 113,335,309		probably benign	Het
Btbd11	G	A	10: 85,658,336	G1106D	probably damaging	Het
Cdh7	C	A	1: 110,052,966	T208K	probably damaging	Het
Cnga4	A	G	7: 105,405,818	Y100C	probably damaging	Het
Dnah10	G	A	5: 124,800,953	V2644M	probably damaging	Het
Dnah9	T	C	11: 65,965,689	D2882G	probably damaging	Het
Eapp	T	A	12: 54,685,962	K117M	probably damaging	Het
Eml3	T	C	19: 8,939,063	V673A	probably benign	Het
Ephb4	G	A	5: 137,369,855	C754Y	probably damaging	Het
Eps8l1	A	G	7: 4,477,957	D33G	possibly damaging	Het
Farsa	A	G	8: 84,867,583	K321E	probably damaging	Het
Fry	G	A	5: 150,437,159	R2090Q	probably damaging	Het
Gm10283	A	G	8: 60,501,224		probably benign	Het
Grm4	A	G	17: 27,431,490	I844T	probably benign	Het
Gtf2h3	A	G	5: 124,588,628	D124G	probably benign	Het
Gulo	A	T	14: 65,990,441	D347E	probably damaging	Het
Hmcn1	A	G	1: 150,609,801	F4350S	possibly damaging	Het
Hspg2	A	G	4: 137,512,401	D473G	probably damaging	Het
Il17ra	T	A	6: 120,481,505	I539N	probably damaging	Het
Insrr	A	G	3: 87,813,133	E1026G	probably damaging	Het
Itga2	A	T	13: 114,856,650		probably benign	Het
Kdm1b	A	T	13: 47,058,810	D190V	possibly damaging	Het
Lima1	A	T	15: 99,802,159	N146K	probably damaging	Het
Mettl7a3	A	T	15: 100,335,383	N152Y	possibly damaging	Het
Mnt	G	T	11: 74,842,296	V85L	probably benign	Het
Mon2	T	A	10: 123,026,065		probably benign	Het
Mtf1	T	C	4: 124,820,201		probably benign	Het
Mylk4	T	C	13: 32,712,754		probably null	Het
Myo18b	A	C	5: 112,865,750	L780R	probably damaging	Het
Myo1e	A	G	9: 70,376,660		probably benign	Het
Obscn	A	G	11: 59,073,696	S705P	probably damaging	Het
Ocrl	A	T	X: 47,936,086		probably benign	Het
Olfr1260	T	C	2: 89,978,201	F141S	probably benign	Het
Olfr394	A	T	11: 73,887,904	M156K	probably benign	Het
Olfr599	A	G	7: 103,338,186	N44S	probably damaging	Het
Olfr639	A	T	7: 104,012,188	C171*	probably null	Het
Plcxd3	A	G	15: 4,516,867	S118G	probably damaging	Het
Plcz1	T	A	6: 140,028,542	Q58L	probably benign	Het
Proser1	C	A	3: 53,479,064	P789Q	probably benign	Het
Rassf4	T	C	6: 116,645,936	E38G	probably damaging	Het
Ros1	A	T	10: 52,123,300	Y1164N	probably damaging	Het
Rpgrip1l	A	G	8: 91,305,000	I83T	probably damaging	Het
Scn9a	T	G	2: 66,526,799	K1053Q	probably damaging	Het
Sgsm1	G	T	5: 113,245,028	Q1087K	probably damaging	Het
Slc16a10	T	C	10: 40,141,918	D40G	probably benign	Het
Slc27a6	A	G	18: 58,556,813	D117G	probably damaging	Het
Slc2a9	T	A	5: 38,480,144		probably benign	Het
Slc4a1	A	G	11: 102,357,915		probably benign	Het
Smarca1	T	A	X: 47,823,426	Q982L	probably benign	Het
Sp100	T	A	1: 85,681,110	I320N	possibly damaging	Het
Stx8	A	T	11: 68,109,362	R209S	probably null	Het
Sulf2	T	C	2: 166,083,879	T453A	possibly damaging	Het
Syne2	AGAGTGAG	AGAGTGAGTGAG	12: 76,097,960		probably null	Het
Tenm2	T	A	11: 36,024,780	I1976F	possibly damaging	Het
Tenm3	G	A	8: 48,277,710	S1341L	probably damaging	Het
Tmem130	C	T	5: 144,737,809	V369M	probably damaging	Het
Tmem200c	A	G	17: 68,840,511	K30E	probably damaging	Het
Tmem225	A	G	9: 40,149,747	I117V	possibly damaging	Het
Top2a	A	G	11: 99,001,417	I1073T	probably damaging	Het
Trps1	A	C	15: 50,831,860	Y296*	probably null	Het
Tubg1	T	C	11: 101,125,336	M377T	probably benign	Het
Vmn1r35	G	A	6: 66,679,513	H58Y	probably benign	Het
Vmn1r56	G	A	7: 5,196,430	H63Y	probably benign	Het
Vmn1r75	T	C	7: 11,881,262		probably null	Het
Vnn3	T	C	10: 23,865,705	S303P	possibly damaging	Het
Wdr49	C	T	3: 75,431,076		probably null	Het
Wdr49	T	C	3: 75,449,890		probably null	Het
Zcchc6	A	G	13: 59,809,487	V7A	probably damaging	Het
Zzef1	T	C	11: 72,913,178	L2582P	probably damaging	Het

Other mutations in Otof

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Otof	APN	5	30375904	missense	probably damaging	1.00
IGL00391:Otof	APN	5	30375623	missense	probably damaging	1.00
IGL00579:Otof	APN	5	30399322	missense	possibly damaging	0.88
IGL00671:Otof	APN	5	30385753	critical splice donor site	probably null
IGL01019:Otof	APN	5	30405216	missense	probably benign	0.01
IGL01025:Otof	APN	5	30384253	missense	possibly damaging	0.82
IGL01086:Otof	APN	5	30376273	critical splice donor site	probably null
IGL01110:Otof	APN	5	30461725	missense	probably damaging	1.00
IGL01160:Otof	APN	5	30381535	missense	probably benign	0.00
IGL01285:Otof	APN	5	30405183	missense	probably damaging	1.00
IGL01329:Otof	APN	5	30441379	missense	probably benign	0.00
IGL01337:Otof	APN	5	30405777	missense	possibly damaging	0.93
IGL01337:Otof	APN	5	30419512	missense	probably benign	0.17
IGL01834:Otof	APN	5	30399220	missense	probably damaging	1.00
IGL01872:Otof	APN	5	30379254	splice site	probably benign
IGL01969:Otof	APN	5	30382483	splice site	probably benign
IGL02075:Otof	APN	5	30370726	missense	probably benign	0.23
IGL02077:Otof	APN	5	30399235	missense	probably damaging	1.00
IGL02136:Otof	APN	5	30373992	missense	possibly damaging	0.90
IGL02227:Otof	APN	5	30370784	missense	probably damaging	1.00
IGL02475:Otof	APN	5	30376682	missense	probably damaging	1.00
IGL02812:Otof	APN	5	30374082	missense	probably benign	0.08
IGL02864:Otof	APN	5	30386341	missense	probably damaging	0.99
IGL03176:Otof	APN	5	30405176	splice site	probably null
R0285:Otof	UTSW	5	30379533	critical splice donor site	probably null
R0421:Otof	UTSW	5	30371568	missense	possibly damaging	0.94
R0570:Otof	UTSW	5	30371881	splice site	probably benign
R0675:Otof	UTSW	5	30382361	missense	probably benign	0.01
R0715:Otof	UTSW	5	30394697	missense	probably damaging	0.99
R1019:Otof	UTSW	5	30370743	missense	probably damaging	0.96
R1183:Otof	UTSW	5	30371912	missense	probably damaging	1.00
R1435:Otof	UTSW	5	30378695	missense	probably benign	0.00
R1469:Otof	UTSW	5	30380227	missense	probably benign	0.00
R1469:Otof	UTSW	5	30380227	missense	probably benign	0.00
R1474:Otof	UTSW	5	30379532	critical splice donor site	probably null
R1524:Otof	UTSW	5	30379556	missense	probably benign	0.03
R1563:Otof	UTSW	5	30371005	missense	probably benign	0.00
R1732:Otof	UTSW	5	30386471	missense	probably damaging	1.00
R1822:Otof	UTSW	5	30378710	missense	probably benign	0.00
R1845:Otof	UTSW	5	30371723	nonsense	probably null
R1925:Otof	UTSW	5	30394188	missense	probably benign	0.37
R1938:Otof	UTSW	5	30376369	missense	probably benign	0.00
R1968:Otof	UTSW	5	30388654	missense	probably damaging	1.00
R1996:Otof	UTSW	5	30421037	missense	probably benign	0.01
R1999:Otof	UTSW	5	30388772	missense	probably benign	0.19
R2027:Otof	UTSW	5	30421014	missense	probably benign	0.08
R2138:Otof	UTSW	5	30461770	missense	probably benign	0.01
R2173:Otof	UTSW	5	30386374	missense	probably damaging	1.00
R2245:Otof	UTSW	5	30370207	missense	probably damaging	1.00
R3011:Otof	UTSW	5	30382840	missense	probably damaging	1.00
R3105:Otof	UTSW	5	30381801	missense	probably benign	0.03
R3442:Otof	UTSW	5	30371689	missense	probably damaging	1.00
R3710:Otof	UTSW	5	30385266	missense	probably benign
R3715:Otof	UTSW	5	30376871	nonsense	probably null
R3806:Otof	UTSW	5	30386499	critical splice acceptor site	probably null
R3975:Otof	UTSW	5	30370712	missense	probably damaging	1.00
R4067:Otof	UTSW	5	30399291	missense	probably damaging	1.00
R4077:Otof	UTSW	5	30419506	missense	possibly damaging	0.89
R4166:Otof	UTSW	5	30382418	missense	probably damaging	1.00
R4451:Otof	UTSW	5	30385164	missense	possibly damaging	0.77
R4485:Otof	UTSW	5	30375000	missense	possibly damaging	0.77
R4600:Otof	UTSW	5	30371900	missense	probably damaging	1.00
R4646:Otof	UTSW	5	30383570	missense	possibly damaging	0.82
R4648:Otof	UTSW	5	30383570	missense	possibly damaging	0.82
R4669:Otof	UTSW	5	30420974	critical splice donor site	probably null
R4773:Otof	UTSW	5	30394682	missense	probably benign	0.05
R4839:Otof	UTSW	5	30419404	missense	probably damaging	0.99
R4907:Otof	UTSW	5	30378661	critical splice donor site	probably null
R4961:Otof	UTSW	5	30383493	intron	probably benign
R4991:Otof	UTSW	5	30394181	missense	probably damaging	1.00
R5015:Otof	UTSW	5	30382894	missense	probably damaging	1.00
R5036:Otof	UTSW	5	30384439	missense	possibly damaging	0.54
R5038:Otof	UTSW	5	30384439	missense	possibly damaging	0.54
R5253:Otof	UTSW	5	30370139	missense	probably damaging	1.00
R5336:Otof	UTSW	5	30376720	missense	probably benign	0.01
R5365:Otof	UTSW	5	30381800	missense	probably damaging	0.99
R5901:Otof	UTSW	5	30374979	missense	probably damaging	1.00
R6211:Otof	UTSW	5	30371900	missense	probably damaging	0.99
R6318:Otof	UTSW	5	30414544	missense	probably damaging	1.00
R6331:Otof	UTSW	5	30371935	missense	possibly damaging	0.94
R6671:Otof	UTSW	5	30419533	missense	probably benign
R6701:Otof	UTSW	5	30370797	nonsense	probably null
R6792:Otof	UTSW	5	30375634	missense	probably damaging	1.00
R6853:Otof	UTSW	5	30388239	missense	probably damaging	1.00
R6940:Otof	UTSW	5	30371643	missense	probably damaging	0.96
R7037:Otof	UTSW	5	30381538	missense	probably benign	0.32
R7060:Otof	UTSW	5	30388356	missense	possibly damaging	0.84
R7089:Otof	UTSW	5	30371568	missense	possibly damaging	0.94
R7165:Otof	UTSW	5	30375620	missense	probably damaging	0.99
R7178:Otof	UTSW	5	30383534	missense	possibly damaging	0.50
R7298:Otof	UTSW	5	30388270	missense	probably damaging	1.00
R7393:Otof	UTSW	5	30370270	missense	probably benign	0.45
R7397:Otof	UTSW	5	30375707	missense	probably damaging	1.00
R7400:Otof	UTSW	5	30385188	missense	probably benign	0.04
R7428:Otof	UTSW	5	30389825	missense	probably damaging	1.00
R7456:Otof	UTSW	5	30394661	missense	probably damaging	1.00
R7505:Otof	UTSW	5	30371020	missense	probably benign	0.00
R7714:Otof	UTSW	5	30370253	missense	probably damaging	0.99
R8002:Otof	UTSW	5	30380610	missense	probably benign	0.10
R8032:Otof	UTSW	5	30461798	start codon destroyed	probably benign	0.07
R8153:Otof	UTSW	5	30388735	missense	probably damaging	1.00
R8158:Otof	UTSW	5	30380194	missense	probably benign	0.37
R8159:Otof	UTSW	5	30380194	missense	probably benign	0.37
R8441:Otof	UTSW	5	30380856	missense	probably damaging	0.99
R8738:Otof	UTSW	5	30388624	nonsense	probably null
R8813:Otof	UTSW	5	30382898	missense	probably benign	0.02
R8835:Otof	UTSW	5	30370920	missense	probably benign	0.44
R8852:Otof	UTSW	5	30371700	missense	possibly damaging	0.94
R8869:Otof	UTSW	5	30420981	missense	probably benign	0.08
R9029:Otof	UTSW	5	30370075	critical splice donor site	probably null
R9031:Otof	UTSW	5	30380188	missense	probably benign
R9061:Otof	UTSW	5	30388657	missense	possibly damaging	0.50
R9100:Otof	UTSW	5	30382352	missense	possibly damaging	0.80
R9121:Otof	UTSW	5	30379118	missense	probably benign	0.04
R9188:Otof	UTSW	5	30376751	missense	probably damaging	1.00
R9218:Otof	UTSW	5	30385125	missense	probably benign
R9280:Otof	UTSW	5	30371550	missense	probably damaging	0.98
R9395:Otof	UTSW	5	30375632	missense	probably damaging	1.00
R9400:Otof	UTSW	5	30383519	critical splice donor site	probably null
R9407:Otof	UTSW	5	30380921	missense	probably damaging	1.00
R9616:Otof	UTSW	5	30382364	missense	possibly damaging	0.95
R9665:Otof	UTSW	5	30427551	missense	probably benign	0.22
R9748:Otof	UTSW	5	30383654	missense	probably damaging	1.00
R9783:Otof	UTSW	5	30379232	missense	probably benign
Z1176:Otof	UTSW	5	30371586	missense	probably damaging	0.98
Z1177:Otof	UTSW	5	30376297	missense	probably damaging	1.00
Z1177:Otof	UTSW	5	30383658	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTTGAAGGGTTGAAGCCCATGATG -3'
(R):5'- ACTCCGATACGATGTTGCCACAGG -3'

Sequencing Primer
(F):5'- TTGCCTCTGAAGTAAGGGCA -3'
(R):5'- CTATCGAGCTGGACCTGAAC -3'

Posted On

2013-07-11