Incidental Mutation 'R7121:Dnah12'
ID552033
Institutional Source Beutler Lab
Gene Symbol Dnah12
Ensembl Gene ENSMUSG00000021879
Gene Namedynein, axonemal, heavy chain 12
SynonymsDHC3, Hdhc3, HL-19, Dnahc7l, 4921531P07Rik, LOC380889, DLP12, HL19, Dnahc12
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.318) question?
Stock #R7121 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location26693274-26891703 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 26778912 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000022433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022433]
Predicted Effect probably null
Transcript: ENSMUST00000022433
SMART Domains Protein: ENSMUSP00000022433
Gene: ENSMUSG00000021879

DomainStartEndE-ValueType
low complexity region 127 140 N/A INTRINSIC
coiled coil region 588 666 N/A INTRINSIC
Pfam:DHC_N2 676 1113 1.1e-147 PFAM
AAA 1268 1407 1.15e0 SMART
Pfam:AAA_5 1552 1695 1.5e-7 PFAM
Blast:AAA 1709 1827 2e-24 BLAST
Blast:AAA 1848 1898 1e-16 BLAST
AAA 1903 2051 5.42e-4 SMART
Pfam:AAA_8 2238 2316 2e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (71/72)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik C T 19: 42,052,673 A81V probably benign Het
Abcc9 A T 6: 142,689,127 L137* probably null Het
Akap10 A G 11: 61,886,698 probably null Het
Alms1 T A 6: 85,624,622 Y1683N probably damaging Het
Atl1 A G 12: 69,931,634 S127G probably damaging Het
Cadm1 G A 9: 47,799,410 V204M probably damaging Het
Cbr3 T A 16: 93,690,550 I207N probably damaging Het
Ccdc148 A T 2: 58,827,567 Y475N probably damaging Het
Ccdc33 A T 9: 58,080,884 S144T probably benign Het
Ceacam5 C A 7: 17,745,537 A193E probably benign Het
Chd2 T C 7: 73,469,670 D1042G probably benign Het
Chmp5 A T 4: 40,952,217 probably null Het
Clca1 T A 3: 145,011,806 N467I probably damaging Het
D130040H23Rik T C 8: 69,302,279 V112A probably damaging Het
Dbh A T 2: 27,168,306 D162V probably damaging Het
Dnm2 C T 9: 21,474,566 T295I probably benign Het
Faiml A C 9: 99,234,393 D81E probably benign Het
Fer1l4 T A 2: 156,044,557 Y720F probably benign Het
Fn1 A C 1: 71,600,538 probably benign Het
Ftsj3 T C 11: 106,252,297 E397G probably damaging Het
Gm16506 T C 14: 43,727,360 K42E Het
Gpr179 A G 11: 97,334,730 S2200P probably benign Het
Gusb T C 5: 130,000,043 D202G probably benign Het
Hspe1 A G 1: 55,089,151 E35G probably damaging Het
Kptn T A 7: 16,123,098 H170Q probably damaging Het
Lama3 G A 18: 12,462,782 A923T probably benign Het
Lmo7 T A 14: 101,887,035 I432K probably damaging Het
Maneal G A 4: 124,857,112 P284S probably benign Het
Mrgbp A G 2: 180,582,889 T28A probably benign Het
Myo1h T C 5: 114,338,229 V493A Het
Naxd T C 8: 11,506,745 L122P probably damaging Het
Neto2 T C 8: 85,670,391 probably null Het
Obscn T A 11: 59,013,252 R7299* probably null Het
Odf2l G A 3: 145,139,820 V363I possibly damaging Het
Olfr117 T C 17: 37,659,808 H175R probably damaging Het
Olfr1186 A T 2: 88,525,826 D81V probably damaging Het
Olfr1458 T A 19: 13,103,173 I44F probably benign Het
Olfr69 A T 7: 103,767,733 Y221* probably null Het
Olfr721-ps1 A G 14: 14,407,998 T257A possibly damaging Het
Otud3 G A 4: 138,896,756 P325L probably benign Het
Palb2 T C 7: 122,124,834 N564S probably benign Het
Pcnt A G 10: 76,427,927 V401A possibly damaging Het
Plcd4 G A 1: 74,565,365 E767K probably benign Het
Ppp3ca T C 3: 136,868,626 F95S probably damaging Het
Prkar2a A G 9: 108,692,622 T56A probably benign Het
Psma2 T A 13: 14,625,230 D186E probably benign Het
Psmd11 T A 11: 80,438,273 Y72* probably null Het
Ror1 G A 4: 100,302,945 D53N probably benign Het
Rubcn C T 16: 32,836,469 R527Q probably damaging Het
Sgca G A 11: 94,969,547 P255S possibly damaging Het
Skint11 A T 4: 114,227,796 R167S probably benign Het
Slco5a1 A G 1: 12,990,437 V20A probably benign Het
Snai2 T C 16: 14,707,106 S159P probably benign Het
Taar2 T G 10: 23,940,827 S88R probably damaging Het
Tacc3 T A 5: 33,667,165 N378K possibly damaging Het
Tek A G 4: 94,811,410 K342E probably benign Het
Tm9sf3 G T 19: 41,245,505 S198* probably null Het
Tmbim4 T A 10: 120,215,609 F56I possibly damaging Het
Tsen34 T A 7: 3,694,987 S85T probably benign Het
Ttc27 C A 17: 74,747,715 Q339K probably benign Het
Ubap2 G T 4: 41,205,550 P636T probably benign Het
Ubr1 G A 2: 120,875,498 L1495F probably benign Het
Vsig10 T C 5: 117,343,902 S386P probably damaging Het
Wnk2 C A 13: 49,147,177 R19L probably benign Het
Wsb2 T C 5: 117,370,879 L126P probably damaging Het
Xylb A G 9: 119,382,292 I402V probably benign Het
Yrdc A G 4: 124,850,955 S61G probably benign Het
Zbtb3 A G 19: 8,803,407 D128G probably damaging Het
Zfp423 C T 8: 87,780,861 G952R probably damaging Het
Zfp646 A G 7: 127,879,772 T374A possibly damaging Het
Other mutations in Dnah12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Dnah12 APN 14 26771005 missense probably damaging 1.00
IGL01602:Dnah12 APN 14 26710275 splice site probably benign
IGL01681:Dnah12 APN 14 26722160 missense probably benign
IGL02082:Dnah12 APN 14 26707162 missense possibly damaging 0.79
IGL02140:Dnah12 APN 14 26716577 missense probably benign 0.20
IGL02170:Dnah12 APN 14 26773112 missense probably damaging 0.99
IGL02174:Dnah12 APN 14 26706917 missense probably benign 0.00
IGL02367:Dnah12 APN 14 26709161 missense probably benign 0.30
IGL02418:Dnah12 APN 14 26773722 missense probably damaging 1.00
IGL03039:Dnah12 APN 14 26724512 missense probably benign 0.02
IGL03066:Dnah12 APN 14 26697398 missense probably benign 0.06
drippings UTSW 14 26854804 missense probably damaging 1.00
grueben UTSW 14 26878079 missense probably damaging 1.00
F5770:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
FR4304:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4340:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4342:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4589:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
IGL03055:Dnah12 UTSW 14 26872740 missense probably damaging 1.00
LCD18:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
R0003:Dnah12 UTSW 14 26772644 missense probably damaging 1.00
R0110:Dnah12 UTSW 14 26798899 missense probably damaging 1.00
R0302:Dnah12 UTSW 14 26799999 missense probably damaging 1.00
R0355:Dnah12 UTSW 14 26706117 intron probably null
R0364:Dnah12 UTSW 14 26724473 missense probably benign 0.10
R0469:Dnah12 UTSW 14 26798899 missense probably damaging 1.00
R0558:Dnah12 UTSW 14 26709310 missense probably benign 0.00
R0709:Dnah12 UTSW 14 26884265 splice site probably benign
R0734:Dnah12 UTSW 14 26800013 missense probably benign 0.00
R1273:Dnah12 UTSW 14 26739220 nonsense probably null
R1496:Dnah12 UTSW 14 26710248 missense probably benign
R1503:Dnah12 UTSW 14 26773692 missense probably damaging 1.00
R1535:Dnah12 UTSW 14 26816322 missense possibly damaging 0.91
R1608:Dnah12 UTSW 14 26766190 missense probably damaging 1.00
R1682:Dnah12 UTSW 14 26778883 missense possibly damaging 0.71
R1758:Dnah12 UTSW 14 26766114 missense probably benign 0.02
R1826:Dnah12 UTSW 14 26711019 missense probably benign 0.01
R1829:Dnah12 UTSW 14 26773023 missense probably damaging 1.00
R1829:Dnah12 UTSW 14 26800075 missense probably damaging 1.00
R1862:Dnah12 UTSW 14 26697398 missense probably benign 0.06
R1862:Dnah12 UTSW 14 26709257 missense probably benign 0.30
R1913:Dnah12 UTSW 14 26792264 splice site probably null
R1933:Dnah12 UTSW 14 26734495 missense probably damaging 0.98
R2006:Dnah12 UTSW 14 26814459 missense possibly damaging 0.95
R2045:Dnah12 UTSW 14 26781528 missense probably null 1.00
R2113:Dnah12 UTSW 14 26766141 missense probably damaging 1.00
R2125:Dnah12 UTSW 14 26724458 nonsense probably null
R2126:Dnah12 UTSW 14 26724458 nonsense probably null
R2207:Dnah12 UTSW 14 26781787 missense probably damaging 0.99
R2213:Dnah12 UTSW 14 26739330 missense probably benign 0.06
R2511:Dnah12 UTSW 14 26769950 missense possibly damaging 0.65
R2875:Dnah12 UTSW 14 26693470 missense probably benign 0.04
R2875:Dnah12 UTSW 14 26876950 missense probably benign 0.05
R3551:Dnah12 UTSW 14 26770972 missense probably benign 0.01
R3713:Dnah12 UTSW 14 26812790 missense probably benign
R3729:Dnah12 UTSW 14 26706065 missense probably benign 0.02
R3799:Dnah12 UTSW 14 26770923 missense probably damaging 1.00
R3846:Dnah12 UTSW 14 26710211 missense probably benign 0.00
R3892:Dnah12 UTSW 14 26856616 missense probably benign 0.03
R3921:Dnah12 UTSW 14 26771051 missense probably damaging 1.00
R3940:Dnah12 UTSW 14 26723599 missense probably benign
R4065:Dnah12 UTSW 14 26770448 missense probably benign 0.02
R4113:Dnah12 UTSW 14 26693567 missense probably damaging 0.98
R4249:Dnah12 UTSW 14 26709186 missense possibly damaging 0.70
R4259:Dnah12 UTSW 14 26798926 missense probably benign 0.01
R4260:Dnah12 UTSW 14 26798926 missense probably benign 0.01
R4348:Dnah12 UTSW 14 26814541 missense possibly damaging 0.94
R4457:Dnah12 UTSW 14 26815507 missense probably damaging 1.00
R4490:Dnah12 UTSW 14 26734603 missense possibly damaging 0.67
R4491:Dnah12 UTSW 14 26734603 missense possibly damaging 0.67
R4494:Dnah12 UTSW 14 26871855 missense probably damaging 0.99
R4523:Dnah12 UTSW 14 26770022 missense probably damaging 0.97
R4523:Dnah12 UTSW 14 26876958 missense possibly damaging 0.83
R4546:Dnah12 UTSW 14 26773014 missense probably damaging 1.00
R4584:Dnah12 UTSW 14 26772594 missense probably damaging 1.00
R4624:Dnah12 UTSW 14 26735758 missense possibly damaging 0.82
R4689:Dnah12 UTSW 14 26706839 missense probably benign 0.00
R4727:Dnah12 UTSW 14 26872317 missense probably damaging 1.00
R4732:Dnah12 UTSW 14 26781784 missense probably damaging 1.00
R4733:Dnah12 UTSW 14 26781784 missense probably damaging 1.00
R4851:Dnah12 UTSW 14 26716629 nonsense probably null
R4879:Dnah12 UTSW 14 26718046 critical splice donor site probably null
R4893:Dnah12 UTSW 14 26710170 missense possibly damaging 0.66
R4915:Dnah12 UTSW 14 26734570 missense probably damaging 1.00
R4927:Dnah12 UTSW 14 26861805 nonsense probably null
R4939:Dnah12 UTSW 14 26891524 missense probably damaging 1.00
R4962:Dnah12 UTSW 14 26716700 missense probably benign 0.00
R5011:Dnah12 UTSW 14 26710171 missense probably benign 0.03
R5013:Dnah12 UTSW 14 26710171 missense probably benign 0.03
R5043:Dnah12 UTSW 14 26884190 missense probably damaging 1.00
R5049:Dnah12 UTSW 14 26735697 missense probably benign 0.09
R5122:Dnah12 UTSW 14 26718000 missense probably benign 0.00
R5135:Dnah12 UTSW 14 26770477 missense probably damaging 0.99
R5149:Dnah12 UTSW 14 26850926 nonsense probably null
R5154:Dnah12 UTSW 14 26849363 missense probably benign 0.12
R5206:Dnah12 UTSW 14 26769985 missense probably damaging 1.00
R5307:Dnah12 UTSW 14 26693486 missense possibly damaging 0.49
R5330:Dnah12 UTSW 14 26773830 missense probably damaging 1.00
R5335:Dnah12 UTSW 14 26879738 missense probably damaging 1.00
R5339:Dnah12 UTSW 14 26814537 missense possibly damaging 0.83
R5354:Dnah12 UTSW 14 26774342 splice site probably null
R5389:Dnah12 UTSW 14 26735749 missense probably damaging 1.00
R5434:Dnah12 UTSW 14 26859299 missense probably damaging 1.00
R5466:Dnah12 UTSW 14 26771050 missense probably damaging 1.00
R5655:Dnah12 UTSW 14 26710269 missense probably benign 0.01
R5681:Dnah12 UTSW 14 26815495 missense probably benign 0.32
R5824:Dnah12 UTSW 14 26770518 critical splice donor site probably null
R5863:Dnah12 UTSW 14 26854921 missense probably damaging 1.00
R5890:Dnah12 UTSW 14 26706884 missense probably benign 0.09
R5912:Dnah12 UTSW 14 26770008 nonsense probably null
R5916:Dnah12 UTSW 14 26706918 missense possibly damaging 0.92
R5941:Dnah12 UTSW 14 26706867 missense probably benign 0.00
R5987:Dnah12 UTSW 14 26886871 missense possibly damaging 0.54
R5992:Dnah12 UTSW 14 26697341 missense probably benign 0.04
R6132:Dnah12 UTSW 14 26717911 missense probably damaging 1.00
R6136:Dnah12 UTSW 14 26875270 missense probably damaging 0.99
R6158:Dnah12 UTSW 14 26773685 missense possibly damaging 0.95
R6183:Dnah12 UTSW 14 26861769 missense probably damaging 1.00
R6191:Dnah12 UTSW 14 26710257 missense probably benign 0.03
R6235:Dnah12 UTSW 14 26854804 missense probably damaging 1.00
R6277:Dnah12 UTSW 14 26770482 missense probably damaging 1.00
R6332:Dnah12 UTSW 14 26717974 missense probably damaging 0.99
R6334:Dnah12 UTSW 14 26706834 missense possibly damaging 0.51
R6443:Dnah12 UTSW 14 26878051 missense probably benign 0.06
R6480:Dnah12 UTSW 14 26872455 missense probably damaging 1.00
R6530:Dnah12 UTSW 14 26735710 missense probably damaging 1.00
R6678:Dnah12 UTSW 14 26735692 missense probably damaging 1.00
R6709:Dnah12 UTSW 14 26872749 missense probably damaging 1.00
R6724:Dnah12 UTSW 14 26796223 missense probably benign 0.02
R6745:Dnah12 UTSW 14 26707228 missense probably damaging 0.99
R6788:Dnah12 UTSW 14 26801513 missense probably damaging 0.99
R6894:Dnah12 UTSW 14 26735749 missense probably damaging 1.00
R6912:Dnah12 UTSW 14 26878079 missense probably damaging 1.00
R6982:Dnah12 UTSW 14 26799076 intron probably null
R7001:Dnah12 UTSW 14 26879724 missense probably damaging 0.99
R7002:Dnah12 UTSW 14 26876998 missense probably damaging 1.00
R7017:Dnah12 UTSW 14 26735680 missense probably benign
R7107:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7108:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7122:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7135:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7135:Dnah12 UTSW 14 26801413 missense probably damaging 0.99
R7150:Dnah12 UTSW 14 26861732 missense probably damaging 0.99
R7188:Dnah12 UTSW 14 26814413 missense probably benign 0.04
R7201:Dnah12 UTSW 14 26814622 missense probably benign 0.08
R7202:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7204:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7204:Dnah12 UTSW 14 26781485 missense probably damaging 0.99
R7205:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7206:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7219:Dnah12 UTSW 14 26854880 missense probably damaging 0.99
R7337:Dnah12 UTSW 14 26766577 splice site probably null
R7339:Dnah12 UTSW 14 26872320 missense probably benign
R7363:Dnah12 UTSW 14 26724611 missense probably benign
R7426:Dnah12 UTSW 14 26724626 missense probably benign 0.01
R7472:Dnah12 UTSW 14 26856635 missense probably benign 0.01
R7579:Dnah12 UTSW 14 26770503 missense probably benign 0.05
R7655:Dnah12 UTSW 14 26859316 missense probably benign 0.21
R7656:Dnah12 UTSW 14 26859316 missense probably benign 0.21
R7694:Dnah12 UTSW 14 26781380 missense probably damaging 1.00
R7730:Dnah12 UTSW 14 26785933 missense probably damaging 1.00
V7580:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
V7581:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
X0018:Dnah12 UTSW 14 26814480 missense probably damaging 1.00
X0027:Dnah12 UTSW 14 26816288 missense probably damaging 1.00
X0065:Dnah12 UTSW 14 26814645 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GCTATGGTATGAAGGGTTATCTAGC -3'
(R):5'- GGATATTTCAACCTGGCCCAG -3'

Sequencing Primer
(F):5'- TGGCAAACACCATTAGAATTGTTC -3'
(R):5'- TGGCCCAGATTCGGGACATTTC -3'
Posted On2019-05-15