Incidental Mutation 'R7121:Olfr1458'
ID552043
Institutional Source Beutler Lab
Gene Symbol Olfr1458
Ensembl Gene ENSMUSG00000062844
Gene Nameolfactory receptor 1458
SynonymsEG667271, MOR202-24, GA_x6K02T2RE5P-3430689-3429787
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R7121 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location13101593-13106775 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13103173 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 44 (I44F)
Ref Sequence ENSEMBL: ENSMUSP00000149865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076729] [ENSMUST00000215160]
Predicted Effect probably benign
Transcript: ENSMUST00000076729
AA Change: I38F

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000076019
Gene: ENSMUSG00000062844
AA Change: I38F

DomainStartEndE-ValueType
Pfam:7tm_4 23 300 7.9e-51 PFAM
Pfam:7TM_GPCR_Srsx 27 297 1.2e-6 PFAM
Pfam:7tm_1 33 282 5.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215160
AA Change: I44F

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik C T 19: 42,052,673 A81V probably benign Het
Abcc9 A T 6: 142,689,127 L137* probably null Het
Akap10 A G 11: 61,886,698 probably null Het
Alms1 T A 6: 85,624,622 Y1683N probably damaging Het
Atl1 A G 12: 69,931,634 S127G probably damaging Het
Cadm1 G A 9: 47,799,410 V204M probably damaging Het
Cbr3 T A 16: 93,690,550 I207N probably damaging Het
Ccdc148 A T 2: 58,827,567 Y475N probably damaging Het
Ccdc33 A T 9: 58,080,884 S144T probably benign Het
Ceacam5 C A 7: 17,745,537 A193E probably benign Het
Chd2 T C 7: 73,469,670 D1042G probably benign Het
Chmp5 A T 4: 40,952,217 probably null Het
Clca1 T A 3: 145,011,806 N467I probably damaging Het
D130040H23Rik T C 8: 69,302,279 V112A probably damaging Het
Dbh A T 2: 27,168,306 D162V probably damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dnm2 C T 9: 21,474,566 T295I probably benign Het
Faiml A C 9: 99,234,393 D81E probably benign Het
Fer1l4 T A 2: 156,044,557 Y720F probably benign Het
Fn1 A C 1: 71,600,538 probably benign Het
Ftsj3 T C 11: 106,252,297 E397G probably damaging Het
Gm16506 T C 14: 43,727,360 K42E Het
Gpr179 A G 11: 97,334,730 S2200P probably benign Het
Gusb T C 5: 130,000,043 D202G probably benign Het
Hspe1 A G 1: 55,089,151 E35G probably damaging Het
Kptn T A 7: 16,123,098 H170Q probably damaging Het
Lama3 G A 18: 12,462,782 A923T probably benign Het
Lmo7 T A 14: 101,887,035 I432K probably damaging Het
Maneal G A 4: 124,857,112 P284S probably benign Het
Mrgbp A G 2: 180,582,889 T28A probably benign Het
Myo1h T C 5: 114,338,229 V493A Het
Naxd T C 8: 11,506,745 L122P probably damaging Het
Neto2 T C 8: 85,670,391 probably null Het
Obscn T A 11: 59,013,252 R7299* probably null Het
Odf2l G A 3: 145,139,820 V363I possibly damaging Het
Olfr117 T C 17: 37,659,808 H175R probably damaging Het
Olfr1186 A T 2: 88,525,826 D81V probably damaging Het
Olfr69 A T 7: 103,767,733 Y221* probably null Het
Olfr721-ps1 A G 14: 14,407,998 T257A possibly damaging Het
Otud3 G A 4: 138,896,756 P325L probably benign Het
Palb2 T C 7: 122,124,834 N564S probably benign Het
Pcnt A G 10: 76,427,927 V401A possibly damaging Het
Plcd4 G A 1: 74,565,365 E767K probably benign Het
Ppp3ca T C 3: 136,868,626 F95S probably damaging Het
Prkar2a A G 9: 108,692,622 T56A probably benign Het
Psma2 T A 13: 14,625,230 D186E probably benign Het
Psmd11 T A 11: 80,438,273 Y72* probably null Het
Ror1 G A 4: 100,302,945 D53N probably benign Het
Rubcn C T 16: 32,836,469 R527Q probably damaging Het
Sgca G A 11: 94,969,547 P255S possibly damaging Het
Skint11 A T 4: 114,227,796 R167S probably benign Het
Slco5a1 A G 1: 12,990,437 V20A probably benign Het
Snai2 T C 16: 14,707,106 S159P probably benign Het
Taar2 T G 10: 23,940,827 S88R probably damaging Het
Tacc3 T A 5: 33,667,165 N378K possibly damaging Het
Tek A G 4: 94,811,410 K342E probably benign Het
Tm9sf3 G T 19: 41,245,505 S198* probably null Het
Tmbim4 T A 10: 120,215,609 F56I possibly damaging Het
Tsen34 T A 7: 3,694,987 S85T probably benign Het
Ttc27 C A 17: 74,747,715 Q339K probably benign Het
Ubap2 G T 4: 41,205,550 P636T probably benign Het
Ubr1 G A 2: 120,875,498 L1495F probably benign Het
Vsig10 T C 5: 117,343,902 S386P probably damaging Het
Wnk2 C A 13: 49,147,177 R19L probably benign Het
Wsb2 T C 5: 117,370,879 L126P probably damaging Het
Xylb A G 9: 119,382,292 I402V probably benign Het
Yrdc A G 4: 124,850,955 S61G probably benign Het
Zbtb3 A G 19: 8,803,407 D128G probably damaging Het
Zfp423 C T 8: 87,780,861 G952R probably damaging Het
Zfp646 A G 7: 127,879,772 T374A possibly damaging Het
Other mutations in Olfr1458
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01684:Olfr1458 APN 19 13102989 missense possibly damaging 0.93
IGL02319:Olfr1458 APN 19 13102662 missense probably benign 0.14
IGL02926:Olfr1458 APN 19 13102823 missense possibly damaging 0.74
IGL03107:Olfr1458 APN 19 13103037 missense probably benign
IGL03304:Olfr1458 APN 19 13102741 missense probably damaging 1.00
R0046:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0049:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0099:Olfr1458 UTSW 19 13103140 missense probably benign 0.07
R0103:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0144:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0189:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0206:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0207:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0208:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0212:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0344:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0426:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0506:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0507:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0607:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0661:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0734:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R1347:Olfr1458 UTSW 19 13102690 missense probably benign 0.03
R1347:Olfr1458 UTSW 19 13102690 missense probably benign 0.03
R1443:Olfr1458 UTSW 19 13103204 nonsense probably null
R1446:Olfr1458 UTSW 19 13103016 missense possibly damaging 0.59
R1567:Olfr1458 UTSW 19 13102642 missense probably benign 0.00
R2190:Olfr1458 UTSW 19 13102493 missense probably damaging 1.00
R2438:Olfr1458 UTSW 19 13102421 missense probably benign 0.00
R4020:Olfr1458 UTSW 19 13102426 missense probably damaging 0.99
R4406:Olfr1458 UTSW 19 13102594 missense possibly damaging 0.70
R4631:Olfr1458 UTSW 19 13103272 missense probably benign 0.07
R4847:Olfr1458 UTSW 19 13102534 missense probably damaging 1.00
R4979:Olfr1458 UTSW 19 13102689 missense probably damaging 0.97
R6086:Olfr1458 UTSW 19 13102381 makesense probably null
R6480:Olfr1458 UTSW 19 13102474 missense probably benign 0.34
R6484:Olfr1458 UTSW 19 13103067 missense probably benign 0.34
R6786:Olfr1458 UTSW 19 13103203 missense probably benign 0.09
R7547:Olfr1458 UTSW 19 13103043 missense not run
R7822:Olfr1458 UTSW 19 13103053 missense probably benign 0.00
X0024:Olfr1458 UTSW 19 13103209 missense probably benign 0.22
X0027:Olfr1458 UTSW 19 13103224 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TTCCACGTTGGCAAAGTTTG -3'
(R):5'- GGGCTTCTAACCACTAAAACATCTC -3'

Sequencing Primer
(F):5'- TCCAGCCATGACTTTTGG -3'
(R):5'- ATCTCTCAAACCCCCATTCTAC -3'
Posted On2019-05-15