Incidental Mutation 'R7122:Raph1'
ID 552046
Institutional Source Beutler Lab
Gene Symbol Raph1
Ensembl Gene ENSMUSG00000026014
Gene Name Ras association (RalGDS/AF-6) and pleckstrin homology domains 1
Synonyms C730009O10Rik, lamellipodin, 9430025M21Rik, Lpd
MMRRC Submission 045245-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.120) question?
Stock # R7122 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 60521451-60606263 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 60565136 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 117 (V117D)
Ref Sequence ENSEMBL: ENSMUSP00000120638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027168] [ENSMUST00000090293] [ENSMUST00000140485] [ENSMUST00000142258]
AlphaFold F2Z3U3
Predicted Effect probably benign
Transcript: ENSMUST00000027168
AA Change: V117D

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000027168
Gene: ENSMUSG00000026014
AA Change: V117D

DomainStartEndE-ValueType
low complexity region 201 218 N/A INTRINSIC
low complexity region 294 308 N/A INTRINSIC
RA 322 408 1.63e-13 SMART
PH 450 560 3.38e-11 SMART
low complexity region 581 604 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090293
AA Change: V117D

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000087763
Gene: ENSMUSG00000026014
AA Change: V117D

DomainStartEndE-ValueType
low complexity region 201 218 N/A INTRINSIC
low complexity region 294 308 N/A INTRINSIC
RA 322 408 1.63e-13 SMART
PH 450 560 3.38e-11 SMART
low complexity region 581 604 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000140485
AA Change: V117D
SMART Domains Protein: ENSMUSP00000121023
Gene: ENSMUSG00000026014
AA Change: V117D

DomainStartEndE-ValueType
low complexity region 201 218 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
RA 270 356 1.63e-13 SMART
PH 398 508 3.38e-11 SMART
low complexity region 529 552 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142258
AA Change: V117D

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000120638
Gene: ENSMUSG00000026014
AA Change: V117D

DomainStartEndE-ValueType
low complexity region 202 212 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Mig10/Rap1-interacting adaptor molecule/Lamellipodin family of adapter proteins, which function in cell migration. Members of this family contain pleckstrin-homology domains, Ras-association domains, and proline-rich C-termini. The protein encoded by this gene regulates actin dynamics through interaction with Ena/Vasodilator proteins as well as direct binding to filamentous actin to regulate actin network assembly. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a conditional allele activated in all cells exhibit background sensitive neonatal or postnatal lethality, decreased body size, belly spotting and decreased melanocyte numbers in the trunk. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 T A 13: 4,561,275 (GRCm39) E126V probably benign Het
Alg3 A T 16: 20,426,602 (GRCm39) L213H probably damaging Het
Atp1a4 T A 1: 172,059,503 (GRCm39) Y863F possibly damaging Het
Atp6v0e A G 17: 26,914,390 (GRCm39) T72A probably benign Het
Aup1 A G 6: 83,032,123 (GRCm39) T97A probably benign Het
Bcl6 T C 16: 23,791,652 (GRCm39) D234G probably damaging Het
Cdc42bpa T C 1: 179,892,583 (GRCm39) L249P probably damaging Het
Celsr3 A G 9: 108,705,766 (GRCm39) K750E possibly damaging Het
Ces1g C A 8: 94,043,665 (GRCm39) G425C possibly damaging Het
Chl1 T C 6: 103,683,409 (GRCm39) L745P probably damaging Het
Csmd2 G A 4: 128,343,020 (GRCm39) V1471M Het
Dnah12 G A 14: 26,500,869 (GRCm39) probably null Het
E4f1 G A 17: 24,663,808 (GRCm39) Q569* probably null Het
Efcab3 A T 11: 104,899,787 (GRCm39) I4350F possibly damaging Het
Fbxw24 A T 9: 109,430,328 (GRCm39) C439S probably benign Het
Ftdc2 C A 16: 58,458,140 (GRCm39) A54S probably benign Het
Gmip C T 8: 70,270,452 (GRCm39) P721S probably benign Het
Grip1 A G 10: 119,871,279 (GRCm39) I669V possibly damaging Het
Gsn A T 2: 35,185,061 (GRCm39) K339* probably null Het
Herc1 G T 9: 66,307,056 (GRCm39) A959S possibly damaging Het
Hic1 A G 11: 75,060,056 (GRCm39) V97A probably benign Het
Il11ra1 A G 4: 41,766,189 (GRCm39) Y242C probably damaging Het
Iqsec3 A C 6: 121,450,317 (GRCm39) V69G unknown Het
Jak3 T A 8: 72,138,601 (GRCm39) M933K probably damaging Het
Kbtbd7 G A 14: 79,665,757 (GRCm39) V530I probably damaging Het
Kif22 G A 7: 126,632,150 (GRCm39) R345C probably benign Het
Klhl7 G A 5: 24,343,433 (GRCm39) E250K probably damaging Het
Klk1b4 A G 7: 43,860,531 (GRCm39) H183R probably damaging Het
Lhfpl4 C T 6: 113,153,632 (GRCm39) V140I probably benign Het
Lhx5 T A 5: 120,574,410 (GRCm39) M238K probably benign Het
Lin28b A T 10: 45,345,244 (GRCm39) H27Q probably benign Het
Mgat4c A T 10: 102,214,070 (GRCm39) R18* probably null Het
Myct1 C A 10: 5,554,492 (GRCm39) H120N probably damaging Het
Nek1 A T 8: 61,559,829 (GRCm39) D984V probably benign Het
Nfu1 A T 6: 86,986,863 (GRCm39) probably benign Het
Nipsnap1 A T 11: 4,833,366 (GRCm39) probably null Het
Nlrp9c A G 7: 26,085,046 (GRCm39) Y178H probably damaging Het
Nrxn3 T A 12: 89,477,377 (GRCm39) M520K probably damaging Het
Oacyl A G 18: 65,853,323 (GRCm39) D143G probably benign Het
Obox5 A G 7: 15,492,732 (GRCm39) Y229C probably damaging Het
Or1j12 A G 2: 36,342,702 (GRCm39) Y35C probably damaging Het
Or1j18 G A 2: 36,624,436 (GRCm39) M34I probably benign Het
Or2a5 T C 6: 42,874,024 (GRCm39) V213A probably damaging Het
Or52n5 T C 7: 104,588,405 (GRCm39) L224P probably damaging Het
Otogl C T 10: 107,702,515 (GRCm39) A713T probably benign Het
Pcdhb17 A C 18: 37,619,566 (GRCm39) N452T probably benign Het
Pi16 A G 17: 29,545,313 (GRCm39) Y192C probably damaging Het
Pla2g5 T C 4: 138,531,830 (GRCm39) D58G probably damaging Het
Plpp4 G T 7: 128,981,207 (GRCm39) V153F unknown Het
Plxna2 C A 1: 194,326,876 (GRCm39) S270* probably null Het
Pole T A 5: 110,472,968 (GRCm39) probably null Het
Prmt7 T C 8: 106,961,732 (GRCm39) F215S unknown Het
Ptpn21 C T 12: 98,655,171 (GRCm39) V599I probably damaging Het
Rab26 C A 17: 24,749,652 (GRCm39) R131L probably damaging Het
Sacs T C 14: 61,447,845 (GRCm39) V3297A probably damaging Het
Serpine1 C A 5: 137,095,796 (GRCm39) A262S probably benign Het
Sgf29 A G 7: 126,271,221 (GRCm39) D193G probably null Het
Sh3rf2 G A 18: 42,237,227 (GRCm39) probably null Het
Sipa1l1 T C 12: 82,469,236 (GRCm39) V1245A possibly damaging Het
Slc22a7 A G 17: 46,749,224 (GRCm39) L31P probably damaging Het
Slc24a5 G A 2: 124,930,111 (GRCm39) V471I probably benign Het
Slc26a7 A T 4: 14,533,639 (GRCm39) Y395N probably damaging Het
Slc38a2 T C 15: 96,591,182 (GRCm39) M229V probably damaging Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Susd1 G A 4: 59,411,318 (GRCm39) R225* probably null Het
Suz12 T A 11: 79,884,419 (GRCm39) F92I probably damaging Het
Tmem114 C A 16: 8,242,610 (GRCm39) probably benign Het
Tmem68 A G 4: 3,564,107 (GRCm39) V159A probably benign Het
Tpra1 T A 6: 88,885,276 (GRCm39) I76N probably damaging Het
Trim45 A G 3: 100,839,353 (GRCm39) T752A unknown Het
Trp63 C A 16: 25,639,227 (GRCm39) H138Q probably damaging Het
Ugt2a2 T C 5: 87,608,255 (GRCm39) D528G possibly damaging Het
Vmn2r39 T G 7: 9,017,761 (GRCm39) K858N possibly damaging Het
Zfp629 A T 7: 127,210,484 (GRCm39) S442T probably damaging Het
Other mutations in Raph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02300:Raph1 APN 1 60,565,106 (GRCm39) missense possibly damaging 0.76
IGL02900:Raph1 APN 1 60,542,022 (GRCm39) missense probably damaging 1.00
FR4976:Raph1 UTSW 1 60,528,426 (GRCm39) intron probably benign
R0048:Raph1 UTSW 1 60,539,764 (GRCm39) missense probably benign 0.03
R0048:Raph1 UTSW 1 60,539,764 (GRCm39) missense probably benign 0.03
R0049:Raph1 UTSW 1 60,565,058 (GRCm39) missense probably benign 0.03
R0049:Raph1 UTSW 1 60,565,058 (GRCm39) missense probably benign 0.03
R0227:Raph1 UTSW 1 60,565,136 (GRCm39) missense probably benign 0.00
R0387:Raph1 UTSW 1 60,549,655 (GRCm39) intron probably benign
R0607:Raph1 UTSW 1 60,565,028 (GRCm39) missense probably damaging 1.00
R1740:Raph1 UTSW 1 60,558,183 (GRCm39) nonsense probably null
R2274:Raph1 UTSW 1 60,537,659 (GRCm39) missense probably damaging 1.00
R3108:Raph1 UTSW 1 60,532,545 (GRCm39) missense probably benign 0.01
R3977:Raph1 UTSW 1 60,537,682 (GRCm39) missense probably benign 0.39
R4260:Raph1 UTSW 1 60,542,124 (GRCm39) missense possibly damaging 0.94
R4487:Raph1 UTSW 1 60,542,028 (GRCm39) missense possibly damaging 0.68
R4721:Raph1 UTSW 1 60,542,160 (GRCm39) unclassified probably benign
R4782:Raph1 UTSW 1 60,528,273 (GRCm39) missense probably damaging 1.00
R5027:Raph1 UTSW 1 60,535,436 (GRCm39) missense probably damaging 1.00
R5037:Raph1 UTSW 1 60,535,381 (GRCm39) splice site probably null
R5106:Raph1 UTSW 1 60,572,459 (GRCm39) missense probably damaging 1.00
R5506:Raph1 UTSW 1 60,532,657 (GRCm39) intron probably benign
R5510:Raph1 UTSW 1 60,562,105 (GRCm39) unclassified probably benign
R5587:Raph1 UTSW 1 60,537,632 (GRCm39) missense probably damaging 1.00
R5591:Raph1 UTSW 1 60,540,905 (GRCm39) unclassified probably benign
R5619:Raph1 UTSW 1 60,529,414 (GRCm39) intron probably benign
R5776:Raph1 UTSW 1 60,529,315 (GRCm39) intron probably benign
R5802:Raph1 UTSW 1 60,527,832 (GRCm39) missense possibly damaging 0.81
R6742:Raph1 UTSW 1 60,564,879 (GRCm39) missense probably damaging 0.97
R7219:Raph1 UTSW 1 60,542,032 (GRCm39) missense unknown
R7251:Raph1 UTSW 1 60,529,027 (GRCm39) missense unknown
R7254:Raph1 UTSW 1 60,538,767 (GRCm39) missense unknown
R7732:Raph1 UTSW 1 60,572,447 (GRCm39) missense possibly damaging 0.82
R7979:Raph1 UTSW 1 60,565,148 (GRCm39) missense probably benign 0.00
R7986:Raph1 UTSW 1 60,535,445 (GRCm39) missense
R8167:Raph1 UTSW 1 60,529,270 (GRCm39) missense unknown
R8168:Raph1 UTSW 1 60,538,779 (GRCm39) missense unknown
R8399:Raph1 UTSW 1 60,528,477 (GRCm39) missense unknown
R9036:Raph1 UTSW 1 60,542,124 (GRCm39) missense unknown
R9146:Raph1 UTSW 1 60,558,137 (GRCm39) critical splice donor site probably null
R9338:Raph1 UTSW 1 60,529,300 (GRCm39) missense unknown
R9381:Raph1 UTSW 1 60,540,959 (GRCm39) missense unknown
R9383:Raph1 UTSW 1 60,564,829 (GRCm39) missense unknown
R9399:Raph1 UTSW 1 60,565,154 (GRCm39) missense probably benign
R9454:Raph1 UTSW 1 60,528,753 (GRCm39) missense unknown
R9561:Raph1 UTSW 1 60,564,887 (GRCm39) missense possibly damaging 0.49
RF018:Raph1 UTSW 1 60,528,426 (GRCm39) intron probably benign
RF022:Raph1 UTSW 1 60,528,426 (GRCm39) intron probably benign
Predicted Primers PCR Primer
(F):5'- TACCAGAGATTGCTGAGCAG -3'
(R):5'- TACCAGAGATCTTAAAGGATAGGC -3'

Sequencing Primer
(F):5'- TGAGCAGCCTCATCCATGC -3'
(R):5'- GCTGACCTCTGCTCTATA -3'
Posted On 2019-05-15