Incidental Mutation 'R7122:Slc26a7'
ID552056
Institutional Source Beutler Lab
Gene Symbol Slc26a7
Ensembl Gene ENSMUSG00000040569
Gene Namesolute carrier family 26, member 7
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R7122 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location14502430-14621805 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 14533639 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 395 (Y395N)
Ref Sequence ENSEMBL: ENSMUSP00000041789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042221]
Predicted Effect probably damaging
Transcript: ENSMUST00000042221
AA Change: Y395N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000041789
Gene: ENSMUSG00000040569
AA Change: Y395N

DomainStartEndE-ValueType
Pfam:Sulfate_transp 47 444 6.9e-95 PFAM
transmembrane domain 445 467 N/A INTRINSIC
Pfam:STAS 493 637 4.7e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one member of a family of sulfate/anion transporter genes. Family members are well conserved in gene structure and protein length yet have markedly different tissue expression patterns. This gene has abundant and specific expression in the kidney. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice deficient for this marker have a reduce arterial pH and reduced serum bicarbonate. Urine is more concentrated and has an elevated pH. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 T A 13: 4,511,276 E126V probably benign Het
Alg3 A T 16: 20,607,852 L213H probably damaging Het
Atp1a4 T A 1: 172,231,936 Y863F possibly damaging Het
Atp6v0e A G 17: 26,695,416 T72A probably benign Het
Aup1 A G 6: 83,055,142 T97A probably benign Het
Bcl6 T C 16: 23,972,902 D234G probably damaging Het
Cdc42bpa T C 1: 180,065,018 L249P probably damaging Het
Celsr3 A G 9: 108,828,567 K750E possibly damaging Het
Ces1g C A 8: 93,317,037 G425C possibly damaging Het
Chl1 T C 6: 103,706,448 L745P probably damaging Het
Csmd2 G A 4: 128,449,227 V1471M Het
Dnah12 G A 14: 26,778,912 probably null Het
E330017A01Rik C A 16: 58,637,777 A54S probably benign Het
E4f1 G A 17: 24,444,834 Q569* probably null Het
Fbxw24 A T 9: 109,601,260 C439S probably benign Het
Gm11639 A T 11: 105,008,961 I4350F possibly damaging Het
Gmip C T 8: 69,817,802 P721S probably benign Het
Grip1 A G 10: 120,035,374 I669V possibly damaging Het
Gsn A T 2: 35,295,049 K339* probably null Het
Herc1 G T 9: 66,399,774 A959S possibly damaging Het
Hic1 A G 11: 75,169,230 V97A probably benign Het
Il11ra1 A G 4: 41,766,189 Y242C probably damaging Het
Iqsec3 A C 6: 121,473,358 V69G unknown Het
Jak3 T A 8: 71,685,957 M933K probably damaging Het
Kbtbd7 G A 14: 79,428,317 V530I probably damaging Het
Kif22 G A 7: 127,032,978 R345C probably benign Het
Klhl7 G A 5: 24,138,435 E250K probably damaging Het
Klk1b4 A G 7: 44,211,107 H183R probably damaging Het
Lhfpl4 C T 6: 113,176,671 V140I probably benign Het
Lhx5 T A 5: 120,436,345 M238K probably benign Het
Lin28b A T 10: 45,469,148 H27Q probably benign Het
Mgat4c A T 10: 102,378,209 R18* probably null Het
Myct1 C A 10: 5,604,492 H120N probably damaging Het
Nek1 A T 8: 61,106,795 D984V probably benign Het
Nfu1 A T 6: 87,009,881 probably benign Het
Nipsnap1 A T 11: 4,883,366 probably null Het
Nlrp9c A G 7: 26,385,621 Y178H probably damaging Het
Nrxn3 T A 12: 89,510,607 M520K probably damaging Het
Oacyl A G 18: 65,720,252 D143G probably benign Het
Obox5 A G 7: 15,758,807 Y229C probably damaging Het
Olfr340 A G 2: 36,452,690 Y35C probably damaging Het
Olfr347 G A 2: 36,734,424 M34I probably benign Het
Olfr448 T C 6: 42,897,090 V213A probably damaging Het
Olfr669 T C 7: 104,939,198 L224P probably damaging Het
Otogl C T 10: 107,866,654 A713T probably benign Het
Pcdhb17 A C 18: 37,486,513 N452T probably benign Het
Pi16 A G 17: 29,326,339 Y192C probably damaging Het
Pla2g5 T C 4: 138,804,519 D58G probably damaging Het
Plpp4 G T 7: 129,379,483 V153F unknown Het
Plxna2 C A 1: 194,644,568 S270* probably null Het
Pole T A 5: 110,325,102 probably null Het
Prmt7 T C 8: 106,235,100 F215S unknown Het
Ptpn21 C T 12: 98,688,912 V599I probably damaging Het
Rab26 C A 17: 24,530,678 R131L probably damaging Het
Raph1 A T 1: 60,525,977 V117D probably benign Het
Sacs T C 14: 61,210,396 V3297A probably damaging Het
Serpine1 C A 5: 137,066,942 A262S probably benign Het
Sgf29 A G 7: 126,672,049 D193G probably null Het
Sh3rf2 G A 18: 42,104,162 probably null Het
Sipa1l1 T C 12: 82,422,462 V1245A possibly damaging Het
Slc22a7 A G 17: 46,438,298 L31P probably damaging Het
Slc24a5 G A 2: 125,088,191 V471I probably benign Het
Slc38a2 T C 15: 96,693,301 M229V probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Susd1 G A 4: 59,411,318 R225* probably null Het
Suz12 T A 11: 79,993,593 F92I probably damaging Het
Tmem114 C A 16: 8,424,746 probably benign Het
Tmem68 A G 4: 3,564,107 V159A probably benign Het
Tpra1 T A 6: 88,908,294 I76N probably damaging Het
Trim45 A G 3: 100,932,037 T752A unknown Het
Trp63 C A 16: 25,820,477 H138Q probably damaging Het
Ugt2a2 T C 5: 87,460,396 D528G possibly damaging Het
Vmn2r39 T G 7: 9,014,762 K858N possibly damaging Het
Zfp629 A T 7: 127,611,312 S442T probably damaging Het
Other mutations in Slc26a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Slc26a7 APN 4 14548403 splice site probably benign
IGL00943:Slc26a7 APN 4 14506477 missense probably benign 0.01
IGL01878:Slc26a7 APN 4 14519388 splice site probably null
IGL02698:Slc26a7 APN 4 14593867 missense possibly damaging 0.93
IGL03133:Slc26a7 APN 4 14532576 missense possibly damaging 0.49
R0200:Slc26a7 UTSW 4 14621317 missense probably benign 0.04
R0240:Slc26a7 UTSW 4 14532651 missense probably damaging 1.00
R0240:Slc26a7 UTSW 4 14532651 missense probably damaging 1.00
R0608:Slc26a7 UTSW 4 14621317 missense probably benign 0.04
R0833:Slc26a7 UTSW 4 14593873 missense probably damaging 1.00
R1496:Slc26a7 UTSW 4 14506489 missense probably benign 0.01
R1592:Slc26a7 UTSW 4 14552470 missense probably benign 0.09
R1656:Slc26a7 UTSW 4 14621221 missense possibly damaging 0.90
R1758:Slc26a7 UTSW 4 14548491 missense possibly damaging 0.58
R1861:Slc26a7 UTSW 4 14522873 missense probably benign
R2429:Slc26a7 UTSW 4 14506399 splice site probably benign
R2850:Slc26a7 UTSW 4 14593806 splice site probably benign
R3442:Slc26a7 UTSW 4 14565511 missense probably benign 0.11
R4158:Slc26a7 UTSW 4 14544197 missense probably benign 0.38
R4160:Slc26a7 UTSW 4 14544197 missense probably benign 0.38
R4721:Slc26a7 UTSW 4 14510261 splice site probably null
R4727:Slc26a7 UTSW 4 14590477 missense probably damaging 1.00
R4825:Slc26a7 UTSW 4 14546309 missense probably benign 0.18
R4992:Slc26a7 UTSW 4 14565508 missense probably damaging 1.00
R5024:Slc26a7 UTSW 4 14532572 missense possibly damaging 0.91
R5344:Slc26a7 UTSW 4 14519402 missense probably benign 0.00
R5373:Slc26a7 UTSW 4 14546447 missense probably damaging 0.99
R5540:Slc26a7 UTSW 4 14506621 missense probably benign
R6046:Slc26a7 UTSW 4 14505471 missense probably benign 0.24
R6320:Slc26a7 UTSW 4 14524498 missense probably benign 0.01
R6685:Slc26a7 UTSW 4 14593819 missense probably damaging 1.00
R6685:Slc26a7 UTSW 4 14593820 missense probably damaging 1.00
R6880:Slc26a7 UTSW 4 14516159 missense possibly damaging 0.57
R6958:Slc26a7 UTSW 4 14506442 missense probably benign 0.00
R7000:Slc26a7 UTSW 4 14552476 missense probably benign
R7090:Slc26a7 UTSW 4 14565460 nonsense probably null
R7361:Slc26a7 UTSW 4 14546305 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTAGTTCGCCTGAAAAGCC -3'
(R):5'- ACAGCTAAGGACAGATCATGC -3'

Sequencing Primer
(F):5'- CTAGTTCGCCTGAAAAGCCAGAAG -3'
(R):5'- GCTAAGGACAGATCATGCAATTTAAC -3'
Posted On2019-05-15