Incidental Mutation 'R0599:Gtf2h3'
ID 55206
Institutional Source Beutler Lab
Gene Symbol Gtf2h3
Ensembl Gene ENSMUSG00000029387
Gene Name general transcription factor IIH, polypeptide 3
Synonyms 34kDa, BTF2, D5Ertd679e, 5033417D07Rik
MMRRC Submission 038788-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock # R0599 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 124579140-124597680 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 124588628 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 124 (D124G)
Ref Sequence ENSEMBL: ENSMUSP00000031333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031333]
AlphaFold Q8VD76
Predicted Effect probably benign
Transcript: ENSMUST00000031333
AA Change: D124G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000031333
Gene: ENSMUSG00000029387
AA Change: D124G

DomainStartEndE-ValueType
Pfam:Tfb4 8 287 2.1e-108 PFAM
low complexity region 299 306 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126466
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153436
Meta Mutation Damage Score 0.1063 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the TFB4 family. The encoded protein is a subunit of the core-TFIIH basal transcription factor and localizes to the nucleus. The encoded protein is involved in RNA transcription by RNA polymerase II and nucleotide excision repair and associates with the Cdk-activating kinase complex. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 14. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,552,245 L978P probably damaging Het
Abcb1a C T 5: 8,698,539 T290M probably benign Het
Abcd3 A T 3: 121,765,093 F585I probably damaging Het
Acan A G 7: 79,111,290 probably benign Het
Anxa6 T C 11: 54,979,466 D667G possibly damaging Het
Ap3m2 G T 8: 22,793,112 A208D possibly damaging Het
Arhgap17 A T 7: 123,303,790 probably benign Het
Bptf A G 11: 107,068,382 V1838A probably damaging Het
Brip1 T A 11: 86,152,737 M334L probably benign Het
Btbd10 C T 7: 113,335,309 probably benign Het
Btbd11 G A 10: 85,658,336 G1106D probably damaging Het
Cdh7 C A 1: 110,052,966 T208K probably damaging Het
Cnga4 A G 7: 105,405,818 Y100C probably damaging Het
Dnah10 G A 5: 124,800,953 V2644M probably damaging Het
Dnah9 T C 11: 65,965,689 D2882G probably damaging Het
Eapp T A 12: 54,685,962 K117M probably damaging Het
Eml3 T C 19: 8,939,063 V673A probably benign Het
Ephb4 G A 5: 137,369,855 C754Y probably damaging Het
Eps8l1 A G 7: 4,477,957 D33G possibly damaging Het
Farsa A G 8: 84,867,583 K321E probably damaging Het
Fry G A 5: 150,437,159 R2090Q probably damaging Het
Gm10283 A G 8: 60,501,224 probably benign Het
Grm4 A G 17: 27,431,490 I844T probably benign Het
Gulo A T 14: 65,990,441 D347E probably damaging Het
Hmcn1 A G 1: 150,609,801 F4350S possibly damaging Het
Hspg2 A G 4: 137,512,401 D473G probably damaging Het
Il17ra T A 6: 120,481,505 I539N probably damaging Het
Insrr A G 3: 87,813,133 E1026G probably damaging Het
Itga2 A T 13: 114,856,650 probably benign Het
Kdm1b A T 13: 47,058,810 D190V possibly damaging Het
Lima1 A T 15: 99,802,159 N146K probably damaging Het
Mettl7a3 A T 15: 100,335,383 N152Y possibly damaging Het
Mnt G T 11: 74,842,296 V85L probably benign Het
Mon2 T A 10: 123,026,065 probably benign Het
Mtf1 T C 4: 124,820,201 probably benign Het
Mylk4 T C 13: 32,712,754 probably null Het
Myo18b A C 5: 112,865,750 L780R probably damaging Het
Myo1e A G 9: 70,376,660 probably benign Het
Obscn A G 11: 59,073,696 S705P probably damaging Het
Ocrl A T X: 47,936,086 probably benign Het
Olfr1260 T C 2: 89,978,201 F141S probably benign Het
Olfr394 A T 11: 73,887,904 M156K probably benign Het
Olfr599 A G 7: 103,338,186 N44S probably damaging Het
Olfr639 A T 7: 104,012,188 C171* probably null Het
Otof T A 5: 30,370,705 K1931N probably damaging Het
Plcxd3 A G 15: 4,516,867 S118G probably damaging Het
Plcz1 T A 6: 140,028,542 Q58L probably benign Het
Proser1 C A 3: 53,479,064 P789Q probably benign Het
Rassf4 T C 6: 116,645,936 E38G probably damaging Het
Ros1 A T 10: 52,123,300 Y1164N probably damaging Het
Rpgrip1l A G 8: 91,305,000 I83T probably damaging Het
Scn9a T G 2: 66,526,799 K1053Q probably damaging Het
Sgsm1 G T 5: 113,245,028 Q1087K probably damaging Het
Slc16a10 T C 10: 40,141,918 D40G probably benign Het
Slc27a6 A G 18: 58,556,813 D117G probably damaging Het
Slc2a9 T A 5: 38,480,144 probably benign Het
Slc4a1 A G 11: 102,357,915 probably benign Het
Smarca1 T A X: 47,823,426 Q982L probably benign Het
Sp100 T A 1: 85,681,110 I320N possibly damaging Het
Stx8 A T 11: 68,109,362 R209S probably null Het
Sulf2 T C 2: 166,083,879 T453A possibly damaging Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tenm2 T A 11: 36,024,780 I1976F possibly damaging Het
Tenm3 G A 8: 48,277,710 S1341L probably damaging Het
Tmem130 C T 5: 144,737,809 V369M probably damaging Het
Tmem200c A G 17: 68,840,511 K30E probably damaging Het
Tmem225 A G 9: 40,149,747 I117V possibly damaging Het
Top2a A G 11: 99,001,417 I1073T probably damaging Het
Trps1 A C 15: 50,831,860 Y296* probably null Het
Tubg1 T C 11: 101,125,336 M377T probably benign Het
Vmn1r35 G A 6: 66,679,513 H58Y probably benign Het
Vmn1r56 G A 7: 5,196,430 H63Y probably benign Het
Vmn1r75 T C 7: 11,881,262 probably null Het
Vnn3 T C 10: 23,865,705 S303P possibly damaging Het
Wdr49 C T 3: 75,431,076 probably null Het
Wdr49 T C 3: 75,449,890 probably null Het
Zcchc6 A G 13: 59,809,487 V7A probably damaging Het
Zzef1 T C 11: 72,913,178 L2582P probably damaging Het
Other mutations in Gtf2h3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:Gtf2h3 APN 5 124595668 missense probably damaging 0.96
IGL01611:Gtf2h3 APN 5 124595685 missense probably damaging 1.00
IGL01681:Gtf2h3 APN 5 124594791 missense probably damaging 1.00
IGL03097:Gtf2h3 UTSW 5 124602168 unclassified probably benign
R1512:Gtf2h3 UTSW 5 124590870 missense probably damaging 0.99
R1727:Gtf2h3 UTSW 5 124590356 missense probably benign 0.00
R1880:Gtf2h3 UTSW 5 124584273 missense probably benign 0.00
R1881:Gtf2h3 UTSW 5 124584273 missense probably benign 0.00
R1929:Gtf2h3 UTSW 5 124602199 unclassified probably benign
R2149:Gtf2h3 UTSW 5 124599785 unclassified probably benign
R2359:Gtf2h3 UTSW 5 124590876 missense probably damaging 1.00
R2993:Gtf2h3 UTSW 5 124583934 missense probably benign 0.00
R4399:Gtf2h3 UTSW 5 124602063 unclassified probably benign
R4551:Gtf2h3 UTSW 5 124590419 intron probably benign
R5282:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5289:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5566:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5567:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5569:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5570:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5581:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5583:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5709:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5784:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5967:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5968:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R6036:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R6050:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R6518:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R6519:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R6520:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R6526:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R6528:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R7176:Gtf2h3 UTSW 5 124590370 missense probably damaging 0.99
R7184:Gtf2h3 UTSW 5 124584004 missense probably benign 0.22
R8262:Gtf2h3 UTSW 5 124590904 nonsense probably null
R8270:Gtf2h3 UTSW 5 124595987 makesense probably null
R8323:Gtf2h3 UTSW 5 124582471 missense probably benign 0.01
R8361:Gtf2h3 UTSW 5 124595668 missense probably damaging 0.96
R8736:Gtf2h3 UTSW 5 124590909 missense probably damaging 1.00
Z1176:Gtf2h3 UTSW 5 124579175 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACAGAGGCACAGAGTTGCTTACTTG -3'
(R):5'- AGCATTCTCTCTGCATGTGAAGACC -3'

Sequencing Primer
(F):5'- CACAGAGTTGCTTACTTGTGTTTAC -3'
(R):5'- GCACAAGGATACAGCACAGA -3'
Posted On 2013-07-11