Incidental Mutation 'R7122:Nlrp9c'
ID552074
Institutional Source Beutler Lab
Gene Symbol Nlrp9c
Ensembl Gene ENSMUSG00000040614
Gene NameNLR family, pyrin domain containing 9C
SynonymsNalp9c, Nalp-zeta
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7122 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location26322473-26403700 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26385621 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 178 (Y178H)
Ref Sequence ENSEMBL: ENSMUSP00000083106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041845] [ENSMUST00000085944]
Predicted Effect probably damaging
Transcript: ENSMUST00000041845
AA Change: Y178H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036041
Gene: ENSMUSG00000040614
AA Change: Y178H

DomainStartEndE-ValueType
PYRIN 5 87 7.64e-22 SMART
Pfam:NACHT 143 310 5.2e-31 PFAM
LRR 637 664 4.36e1 SMART
Blast:LRR 666 691 3e-6 BLAST
LRR 693 720 1.02e0 SMART
LRR 722 749 3e0 SMART
LRR 750 777 6.88e-4 SMART
LRR 779 806 5.06e0 SMART
LRR 807 834 1.22e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000085944
AA Change: Y178H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000083106
Gene: ENSMUSG00000040614
AA Change: Y178H

DomainStartEndE-ValueType
PYRIN 5 87 7.64e-22 SMART
Pfam:NACHT 143 310 2.8e-31 PFAM
LRR 631 658 7.49e0 SMART
LRR 692 719 4.36e1 SMART
Blast:LRR 721 746 8e-6 BLAST
LRR 748 775 1.02e0 SMART
LRR 777 804 3e0 SMART
LRR 805 832 6.88e-4 SMART
LRR 834 861 2.17e0 SMART
LRR 862 889 2.12e-4 SMART
LRR 919 946 1.22e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (75/76)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 T A 13: 4,511,276 E126V probably benign Het
Alg3 A T 16: 20,607,852 L213H probably damaging Het
Atp1a4 T A 1: 172,231,936 Y863F possibly damaging Het
Atp6v0e A G 17: 26,695,416 T72A probably benign Het
Aup1 A G 6: 83,055,142 T97A probably benign Het
Bcl6 T C 16: 23,972,902 D234G probably damaging Het
Cdc42bpa T C 1: 180,065,018 L249P probably damaging Het
Celsr3 A G 9: 108,828,567 K750E possibly damaging Het
Ces1g C A 8: 93,317,037 G425C possibly damaging Het
Chl1 T C 6: 103,706,448 L745P probably damaging Het
Csmd2 G A 4: 128,449,227 V1471M Het
Dnah12 G A 14: 26,778,912 probably null Het
E330017A01Rik C A 16: 58,637,777 A54S probably benign Het
E4f1 G A 17: 24,444,834 Q569* probably null Het
Fbxw24 A T 9: 109,601,260 C439S probably benign Het
Gm11639 A T 11: 105,008,961 I4350F possibly damaging Het
Gmip C T 8: 69,817,802 P721S probably benign Het
Grip1 A G 10: 120,035,374 I669V possibly damaging Het
Gsn A T 2: 35,295,049 K339* probably null Het
Herc1 G T 9: 66,399,774 A959S possibly damaging Het
Hic1 A G 11: 75,169,230 V97A probably benign Het
Il11ra1 A G 4: 41,766,189 Y242C probably damaging Het
Iqsec3 A C 6: 121,473,358 V69G unknown Het
Jak3 T A 8: 71,685,957 M933K probably damaging Het
Kbtbd7 G A 14: 79,428,317 V530I probably damaging Het
Kif22 G A 7: 127,032,978 R345C probably benign Het
Klhl7 G A 5: 24,138,435 E250K probably damaging Het
Klk1b4 A G 7: 44,211,107 H183R probably damaging Het
Lhfpl4 C T 6: 113,176,671 V140I probably benign Het
Lhx5 T A 5: 120,436,345 M238K probably benign Het
Lin28b A T 10: 45,469,148 H27Q probably benign Het
Mgat4c A T 10: 102,378,209 R18* probably null Het
Myct1 C A 10: 5,604,492 H120N probably damaging Het
Nek1 A T 8: 61,106,795 D984V probably benign Het
Nfu1 A T 6: 87,009,881 probably benign Het
Nipsnap1 A T 11: 4,883,366 probably null Het
Nrxn3 T A 12: 89,510,607 M520K probably damaging Het
Oacyl A G 18: 65,720,252 D143G probably benign Het
Obox5 A G 7: 15,758,807 Y229C probably damaging Het
Olfr340 A G 2: 36,452,690 Y35C probably damaging Het
Olfr347 G A 2: 36,734,424 M34I probably benign Het
Olfr448 T C 6: 42,897,090 V213A probably damaging Het
Olfr669 T C 7: 104,939,198 L224P probably damaging Het
Otogl C T 10: 107,866,654 A713T probably benign Het
Pcdhb17 A C 18: 37,486,513 N452T probably benign Het
Pi16 A G 17: 29,326,339 Y192C probably damaging Het
Pla2g5 T C 4: 138,804,519 D58G probably damaging Het
Plpp4 G T 7: 129,379,483 V153F unknown Het
Plxna2 C A 1: 194,644,568 S270* probably null Het
Pole T A 5: 110,325,102 probably null Het
Prmt7 T C 8: 106,235,100 F215S unknown Het
Ptpn21 C T 12: 98,688,912 V599I probably damaging Het
Rab26 C A 17: 24,530,678 R131L probably damaging Het
Raph1 A T 1: 60,525,977 V117D probably benign Het
Sacs T C 14: 61,210,396 V3297A probably damaging Het
Serpine1 C A 5: 137,066,942 A262S probably benign Het
Sgf29 A G 7: 126,672,049 D193G probably null Het
Sh3rf2 G A 18: 42,104,162 probably null Het
Sipa1l1 T C 12: 82,422,462 V1245A possibly damaging Het
Slc22a7 A G 17: 46,438,298 L31P probably damaging Het
Slc24a5 G A 2: 125,088,191 V471I probably benign Het
Slc26a7 A T 4: 14,533,639 Y395N probably damaging Het
Slc38a2 T C 15: 96,693,301 M229V probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Susd1 G A 4: 59,411,318 R225* probably null Het
Suz12 T A 11: 79,993,593 F92I probably damaging Het
Tmem114 C A 16: 8,424,746 probably benign Het
Tmem68 A G 4: 3,564,107 V159A probably benign Het
Tpra1 T A 6: 88,908,294 I76N probably damaging Het
Trim45 A G 3: 100,932,037 T752A unknown Het
Trp63 C A 16: 25,820,477 H138Q probably damaging Het
Ugt2a2 T C 5: 87,460,396 D528G possibly damaging Het
Vmn2r39 T G 7: 9,014,762 K858N possibly damaging Het
Zfp629 A T 7: 127,611,312 S442T probably damaging Het
Other mutations in Nlrp9c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Nlrp9c APN 7 26384588 missense probably benign 0.00
IGL00814:Nlrp9c APN 7 26384750 missense probably benign 0.23
IGL00919:Nlrp9c APN 7 26394056 nonsense probably null
IGL01762:Nlrp9c APN 7 26385425 missense probably damaging 1.00
IGL01928:Nlrp9c APN 7 26375422 splice site probably benign
IGL02008:Nlrp9c APN 7 26385151 missense probably benign 0.16
IGL02389:Nlrp9c APN 7 26394207 missense probably benign
IGL02535:Nlrp9c APN 7 26372097 missense probably damaging 1.00
IGL02685:Nlrp9c APN 7 26385557 missense probably damaging 0.98
IGL02904:Nlrp9c APN 7 26375290 missense probably damaging 1.00
IGL02935:Nlrp9c APN 7 26385276 missense probably benign 0.00
IGL03006:Nlrp9c APN 7 26372082 missense probably damaging 0.98
IGL03140:Nlrp9c APN 7 26380489 missense probably benign 0.30
IGL03201:Nlrp9c APN 7 26385108 missense probably benign 0.00
IGL03243:Nlrp9c APN 7 26365032 missense probably damaging 0.99
IGL03054:Nlrp9c UTSW 7 26382276 splice site probably null
K7894:Nlrp9c UTSW 7 26384898 missense possibly damaging 0.94
R0018:Nlrp9c UTSW 7 26371998 missense possibly damaging 0.89
R0018:Nlrp9c UTSW 7 26371998 missense possibly damaging 0.89
R0238:Nlrp9c UTSW 7 26378012 missense possibly damaging 0.90
R0238:Nlrp9c UTSW 7 26378012 missense possibly damaging 0.90
R0335:Nlrp9c UTSW 7 26394136 missense possibly damaging 0.92
R0391:Nlrp9c UTSW 7 26371476 splice site probably benign
R0433:Nlrp9c UTSW 7 26385819 missense probably benign 0.20
R1035:Nlrp9c UTSW 7 26371277 splice site probably benign
R1118:Nlrp9c UTSW 7 26384437 missense probably benign 0.01
R1119:Nlrp9c UTSW 7 26384437 missense probably benign 0.01
R1173:Nlrp9c UTSW 7 26380435 missense probably damaging 1.00
R1519:Nlrp9c UTSW 7 26378101 missense possibly damaging 0.88
R1528:Nlrp9c UTSW 7 26382298 missense probably damaging 0.99
R1616:Nlrp9c UTSW 7 26384437 missense probably benign 0.01
R1774:Nlrp9c UTSW 7 26394118 missense probably benign 0.05
R1789:Nlrp9c UTSW 7 26380490 missense probably benign 0.00
R1869:Nlrp9c UTSW 7 26384820 nonsense probably null
R1870:Nlrp9c UTSW 7 26384820 nonsense probably null
R1920:Nlrp9c UTSW 7 26384894 missense probably damaging 1.00
R1987:Nlrp9c UTSW 7 26378056 missense probably benign 0.31
R2022:Nlrp9c UTSW 7 26384796 missense probably damaging 1.00
R2309:Nlrp9c UTSW 7 26378087 missense probably damaging 1.00
R2327:Nlrp9c UTSW 7 26375322 missense probably damaging 1.00
R3405:Nlrp9c UTSW 7 26385282 missense probably benign 0.01
R3548:Nlrp9c UTSW 7 26371451 missense probably damaging 1.00
R3846:Nlrp9c UTSW 7 26382276 splice site probably null
R4179:Nlrp9c UTSW 7 26384661 missense possibly damaging 0.74
R4460:Nlrp9c UTSW 7 26378098 missense probably damaging 1.00
R4669:Nlrp9c UTSW 7 26375368 missense possibly damaging 0.90
R4708:Nlrp9c UTSW 7 26384840 missense probably benign 0.07
R4810:Nlrp9c UTSW 7 26378177 splice site probably null
R4824:Nlrp9c UTSW 7 26380564 missense possibly damaging 0.49
R4915:Nlrp9c UTSW 7 26384460 missense probably benign 0.34
R4996:Nlrp9c UTSW 7 26385747 missense possibly damaging 0.92
R5468:Nlrp9c UTSW 7 26365000 missense probably benign 0.00
R5525:Nlrp9c UTSW 7 26384501 missense probably damaging 1.00
R5526:Nlrp9c UTSW 7 26382366 missense possibly damaging 0.95
R6020:Nlrp9c UTSW 7 26384725 missense probably benign 0.08
R6175:Nlrp9c UTSW 7 26378001 splice site probably null
R6454:Nlrp9c UTSW 7 26385774 missense possibly damaging 0.91
R6493:Nlrp9c UTSW 7 26382387 missense probably damaging 1.00
R6649:Nlrp9c UTSW 7 26371322 missense probably damaging 1.00
R6653:Nlrp9c UTSW 7 26371322 missense probably damaging 1.00
R6739:Nlrp9c UTSW 7 26385425 missense probably damaging 0.99
R6883:Nlrp9c UTSW 7 26378131 missense probably benign 0.18
R7097:Nlrp9c UTSW 7 26385621 missense probably damaging 1.00
R7174:Nlrp9c UTSW 7 26385297 missense probably benign 0.03
R7365:Nlrp9c UTSW 7 26371397 missense possibly damaging 0.93
R7378:Nlrp9c UTSW 7 26365015 missense probably benign 0.14
R7427:Nlrp9c UTSW 7 26371435 missense probably benign 0.00
R7450:Nlrp9c UTSW 7 26364939 missense probably benign 0.45
RF020:Nlrp9c UTSW 7 26385224 missense probably benign
X0065:Nlrp9c UTSW 7 26380430 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATTTTGTGTTGGCAGCCTC -3'
(R):5'- AGCTACAACACCATTATAGATCGTC -3'

Sequencing Primer
(F):5'- GCACAAGTTTGTCCTGAGTTCCAAG -3'
(R):5'- TCGTCAATACAAAGCATTACTGGAC -3'
Posted On2019-05-15