Incidental Mutation 'R0599:Ephb4'
ID55208
Institutional Source Beutler Lab
Gene Symbol Ephb4
Ensembl Gene ENSMUSG00000029710
Gene NameEph receptor B4
SynonymsMDK2, Htk, Myk1, Tyro11
MMRRC Submission 038788-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0599 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location137350109-137378669 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 137369855 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 754 (C754Y)
Ref Sequence ENSEMBL: ENSMUSP00000130275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061244] [ENSMUST00000111054] [ENSMUST00000111055] [ENSMUST00000144296] [ENSMUST00000166239]
Predicted Effect probably damaging
Transcript: ENSMUST00000061244
AA Change: C754Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051622
Gene: ENSMUSG00000029710
AA Change: C754Y

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 2.6e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 8.9e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
SAM 904 971 2.44e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111054
AA Change: C754Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106683
Gene: ENSMUSG00000029710
AA Change: C754Y

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 1.4e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 3.4e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
Pfam:SAM_1 882 917 2.6e-7 PFAM
low complexity region 919 934 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111055
AA Change: C763Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106684
Gene: ENSMUSG00000029710
AA Change: C763Y

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 4.2e-10 PFAM
FN3 324 413 1.75e-6 SMART
FN3 443 525 1.07e-10 SMART
Pfam:EphA2_TM 550 621 5e-24 PFAM
TyrKc 624 883 5.09e-130 SMART
SAM 913 980 2.44e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000144296
AA Change: C754Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115731
Gene: ENSMUSG00000029710
AA Change: C754Y

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 2.6e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 8.9e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
SAM 904 971 2.44e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166239
AA Change: C754Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130275
Gene: ENSMUSG00000029710
AA Change: C754Y

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 2.6e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 8.9e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
SAM 904 971 2.44e-21 SMART
Meta Mutation Damage Score 0.9421 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene binds to ephrin-B2 and plays an essential role in vascular development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit arrested angiogenesis and heart development and midgestational lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,552,245 L978P probably damaging Het
Abcb1a C T 5: 8,698,539 T290M probably benign Het
Abcd3 A T 3: 121,765,093 F585I probably damaging Het
Acan A G 7: 79,111,290 probably benign Het
Anxa6 T C 11: 54,979,466 D667G possibly damaging Het
Ap3m2 G T 8: 22,793,112 A208D possibly damaging Het
Arhgap17 A T 7: 123,303,790 probably benign Het
Bptf A G 11: 107,068,382 V1838A probably damaging Het
Brip1 T A 11: 86,152,737 M334L probably benign Het
Btbd10 C T 7: 113,335,309 probably benign Het
Btbd11 G A 10: 85,658,336 G1106D probably damaging Het
Cdh7 C A 1: 110,052,966 T208K probably damaging Het
Cnga4 A G 7: 105,405,818 Y100C probably damaging Het
Dnah10 G A 5: 124,800,953 V2644M probably damaging Het
Dnah9 T C 11: 65,965,689 D2882G probably damaging Het
Eapp T A 12: 54,685,962 K117M probably damaging Het
Eml3 T C 19: 8,939,063 V673A probably benign Het
Eps8l1 A G 7: 4,477,957 D33G possibly damaging Het
Farsa A G 8: 84,867,583 K321E probably damaging Het
Fry G A 5: 150,437,159 R2090Q probably damaging Het
Gm10283 A G 8: 60,501,224 probably benign Het
Grm4 A G 17: 27,431,490 I844T probably benign Het
Gtf2h3 A G 5: 124,588,628 D124G probably benign Het
Gulo A T 14: 65,990,441 D347E probably damaging Het
Hmcn1 A G 1: 150,609,801 F4350S possibly damaging Het
Hspg2 A G 4: 137,512,401 D473G probably damaging Het
Il17ra T A 6: 120,481,505 I539N probably damaging Het
Insrr A G 3: 87,813,133 E1026G probably damaging Het
Itga2 A T 13: 114,856,650 probably benign Het
Kdm1b A T 13: 47,058,810 D190V possibly damaging Het
Lima1 A T 15: 99,802,159 N146K probably damaging Het
Mettl7a3 A T 15: 100,335,383 N152Y possibly damaging Het
Mnt G T 11: 74,842,296 V85L probably benign Het
Mon2 T A 10: 123,026,065 probably benign Het
Mtf1 T C 4: 124,820,201 probably benign Het
Mylk4 T C 13: 32,712,754 probably null Het
Myo18b A C 5: 112,865,750 L780R probably damaging Het
Myo1e A G 9: 70,376,660 probably benign Het
Obscn A G 11: 59,073,696 S705P probably damaging Het
Ocrl A T X: 47,936,086 probably benign Het
Olfr1260 T C 2: 89,978,201 F141S probably benign Het
Olfr394 A T 11: 73,887,904 M156K probably benign Het
Olfr599 A G 7: 103,338,186 N44S probably damaging Het
Olfr639 A T 7: 104,012,188 C171* probably null Het
Otof T A 5: 30,370,705 K1931N probably damaging Het
Plcxd3 A G 15: 4,516,867 S118G probably damaging Het
Plcz1 T A 6: 140,028,542 Q58L probably benign Het
Proser1 C A 3: 53,479,064 P789Q probably benign Het
Rassf4 T C 6: 116,645,936 E38G probably damaging Het
Ros1 A T 10: 52,123,300 Y1164N probably damaging Het
Rpgrip1l A G 8: 91,305,000 I83T probably damaging Het
Scn9a T G 2: 66,526,799 K1053Q probably damaging Het
Sgsm1 G T 5: 113,245,028 Q1087K probably damaging Het
Slc16a10 T C 10: 40,141,918 D40G probably benign Het
Slc27a6 A G 18: 58,556,813 D117G probably damaging Het
Slc2a9 T A 5: 38,480,144 probably benign Het
Slc4a1 A G 11: 102,357,915 probably benign Het
Smarca1 T A X: 47,823,426 Q982L probably benign Het
Sp100 T A 1: 85,681,110 I320N possibly damaging Het
Stx8 A T 11: 68,109,362 R209S probably null Het
Sulf2 T C 2: 166,083,879 T453A possibly damaging Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tenm2 T A 11: 36,024,780 I1976F possibly damaging Het
Tenm3 G A 8: 48,277,710 S1341L probably damaging Het
Tmem130 C T 5: 144,737,809 V369M probably damaging Het
Tmem200c A G 17: 68,840,511 K30E probably damaging Het
Tmem225 A G 9: 40,149,747 I117V possibly damaging Het
Top2a A G 11: 99,001,417 I1073T probably damaging Het
Trps1 A C 15: 50,831,860 Y296* probably null Het
Tubg1 T C 11: 101,125,336 M377T probably benign Het
Vmn1r35 G A 6: 66,679,513 H58Y probably benign Het
Vmn1r56 G A 7: 5,196,430 H63Y probably benign Het
Vmn1r75 T C 7: 11,881,262 probably null Het
Vnn3 T C 10: 23,865,705 S303P possibly damaging Het
Wdr49 C T 3: 75,431,076 probably null Het
Wdr49 T C 3: 75,449,890 probably null Het
Zcchc6 A G 13: 59,809,487 V7A probably damaging Het
Zzef1 T C 11: 72,913,178 L2582P probably damaging Het
Other mutations in Ephb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00542:Ephb4 APN 5 137365615 splice site probably benign
IGL00948:Ephb4 APN 5 137366659 missense probably damaging 1.00
IGL01653:Ephb4 APN 5 137365741 splice site probably benign
IGL01885:Ephb4 APN 5 137357797 missense probably damaging 1.00
IGL01906:Ephb4 APN 5 137361194 missense probably damaging 1.00
IGL02089:Ephb4 APN 5 137370762 missense probably damaging 0.98
IGL02216:Ephb4 APN 5 137372070 missense possibly damaging 0.92
IGL02233:Ephb4 APN 5 137354501 nonsense probably null
IGL03080:Ephb4 APN 5 137354083 splice site probably benign
IGL03111:Ephb4 APN 5 137372505 missense probably benign 0.07
R0744:Ephb4 UTSW 5 137365667 missense probably damaging 1.00
R1331:Ephb4 UTSW 5 137366534 splice site probably benign
R1441:Ephb4 UTSW 5 137361247 missense probably damaging 1.00
R1732:Ephb4 UTSW 5 137372178 missense possibly damaging 0.93
R1745:Ephb4 UTSW 5 137360434 missense probably benign
R1831:Ephb4 UTSW 5 137354415 missense probably damaging 1.00
R1865:Ephb4 UTSW 5 137363310 missense possibly damaging 0.53
R2165:Ephb4 UTSW 5 137354426 missense probably benign 0.08
R2206:Ephb4 UTSW 5 137357719 missense probably damaging 1.00
R2473:Ephb4 UTSW 5 137365700 missense probably benign 0.15
R4779:Ephb4 UTSW 5 137365702 missense probably benign 0.04
R4801:Ephb4 UTSW 5 137365506 missense probably damaging 1.00
R4802:Ephb4 UTSW 5 137365506 missense probably damaging 1.00
R5307:Ephb4 UTSW 5 137363312 missense probably damaging 1.00
R5452:Ephb4 UTSW 5 137361142 missense probably damaging 1.00
R5458:Ephb4 UTSW 5 137369852 missense probably damaging 1.00
R5475:Ephb4 UTSW 5 137354439 missense probably benign 0.00
R5662:Ephb4 UTSW 5 137372195 missense probably damaging 0.98
R5879:Ephb4 UTSW 5 137360416 missense probably benign 0.00
R6336:Ephb4 UTSW 5 137372085 missense probably damaging 1.00
R6443:Ephb4 UTSW 5 137360449 missense probably damaging 1.00
R6632:Ephb4 UTSW 5 137366587 missense probably damaging 0.99
R6973:Ephb4 UTSW 5 137369804 missense probably damaging 1.00
R7008:Ephb4 UTSW 5 137361274 missense probably benign 0.00
R7145:Ephb4 UTSW 5 137372046 missense probably damaging 1.00
R7421:Ephb4 UTSW 5 137354425 missense possibly damaging 0.88
R7593:Ephb4 UTSW 5 137361298 missense probably benign
R7635:Ephb4 UTSW 5 137372103 missense probably damaging 1.00
R7751:Ephb4 UTSW 5 137365675 missense probably damaging 1.00
R7825:Ephb4 UTSW 5 137372437 missense probably damaging 1.00
X0026:Ephb4 UTSW 5 137373558 missense probably damaging 1.00
Z1177:Ephb4 UTSW 5 137361359 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GTGATTGGTTCATGCCCGTATCCC -3'
(R):5'- AGCAGAGCTGCCAGTACTTCTACC -3'

Sequencing Primer
(F):5'- TGCTGTGTAGACCCCAAGATG -3'
(R):5'- ACCAGGGAACTTGTGTAGGT -3'
Posted On2013-07-11