Incidental Mutation 'R7122:Hic1'
ID552095
Institutional Source Beutler Lab
Gene Symbol Hic1
Ensembl Gene ENSMUSG00000043099
Gene Namehypermethylated in cancer 1
SynonymsHIC-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.368) question?
Stock #R7122 (G1)
Quality Score177.009
Status Validated
Chromosome11
Chromosomal Location75164565-75169519 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75169230 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 97 (V97A)
Ref Sequence ENSEMBL: ENSMUSP00000053483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045281] [ENSMUST00000055619]
Predicted Effect probably benign
Transcript: ENSMUST00000045281
SMART Domains Protein: ENSMUSP00000043555
Gene: ENSMUSG00000038290

DomainStartEndE-ValueType
internal_repeat_1 42 99 7.68e-6 PROSPERO
internal_repeat_1 135 188 7.68e-6 PROSPERO
low complexity region 212 227 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
low complexity region 417 426 N/A INTRINSIC
low complexity region 436 453 N/A INTRINSIC
low complexity region 538 549 N/A INTRINSIC
coiled coil region 574 600 N/A INTRINSIC
Pfam:EST1 637 742 1.8e-18 PFAM
Pfam:EST1_DNA_bind 750 1106 1.6e-78 PFAM
coiled coil region 1197 1234 N/A INTRINSIC
PINc 1245 1396 2.85e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000055619
AA Change: V97A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000053483
Gene: ENSMUSG00000043099
AA Change: V97A

DomainStartEndE-ValueType
low complexity region 71 81 N/A INTRINSIC
low complexity region 192 200 N/A INTRINSIC
BTB 207 313 6.94e-24 SMART
low complexity region 318 340 N/A INTRINSIC
low complexity region 350 370 N/A INTRINSIC
Blast:BTB 375 398 1e-7 BLAST
low complexity region 415 437 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
low complexity region 464 486 N/A INTRINSIC
low complexity region 519 542 N/A INTRINSIC
ZnF_C2H2 597 619 1.08e-1 SMART
ZnF_C2H2 667 689 1.18e-2 SMART
ZnF_C2H2 695 717 9.36e-6 SMART
ZnF_C2H2 723 745 4.54e-4 SMART
ZnF_C2H2 751 773 5.21e-4 SMART
low complexity region 774 804 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130145
SMART Domains Protein: ENSMUSP00000120229
Gene: ENSMUSG00000038290

DomainStartEndE-ValueType
coiled coil region 35 61 N/A INTRINSIC
Pfam:EST1 99 204 1.3e-19 PFAM
Pfam:EST1_DNA_bind 212 339 7.3e-37 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene functions as a growth regulatory and tumor repressor gene. Hypermethylation or deletion of the region of this gene have been associated with tumors and the contiguous-gene syndrome, Miller-Dieker syndrome. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit varying abnormalities, such as acrania, exencephaly, cleft palate, limb defects, and omphalocele, and die perinatally. Heterozygotes develop tumors, including lymphomas, sarcomas, and epithelial cancers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 T A 13: 4,511,276 E126V probably benign Het
Alg3 A T 16: 20,607,852 L213H probably damaging Het
Atp1a4 T A 1: 172,231,936 Y863F possibly damaging Het
Atp6v0e A G 17: 26,695,416 T72A probably benign Het
Aup1 A G 6: 83,055,142 T97A probably benign Het
Bcl6 T C 16: 23,972,902 D234G probably damaging Het
Cdc42bpa T C 1: 180,065,018 L249P probably damaging Het
Celsr3 A G 9: 108,828,567 K750E possibly damaging Het
Ces1g C A 8: 93,317,037 G425C possibly damaging Het
Chl1 T C 6: 103,706,448 L745P probably damaging Het
Csmd2 G A 4: 128,449,227 V1471M Het
Dnah12 G A 14: 26,778,912 probably null Het
E330017A01Rik C A 16: 58,637,777 A54S probably benign Het
E4f1 G A 17: 24,444,834 Q569* probably null Het
Fbxw24 A T 9: 109,601,260 C439S probably benign Het
Gm11639 A T 11: 105,008,961 I4350F possibly damaging Het
Gmip C T 8: 69,817,802 P721S probably benign Het
Grip1 A G 10: 120,035,374 I669V possibly damaging Het
Gsn A T 2: 35,295,049 K339* probably null Het
Herc1 G T 9: 66,399,774 A959S possibly damaging Het
Il11ra1 A G 4: 41,766,189 Y242C probably damaging Het
Iqsec3 A C 6: 121,473,358 V69G unknown Het
Jak3 T A 8: 71,685,957 M933K probably damaging Het
Kbtbd7 G A 14: 79,428,317 V530I probably damaging Het
Kif22 G A 7: 127,032,978 R345C probably benign Het
Klhl7 G A 5: 24,138,435 E250K probably damaging Het
Klk1b4 A G 7: 44,211,107 H183R probably damaging Het
Lhfpl4 C T 6: 113,176,671 V140I probably benign Het
Lhx5 T A 5: 120,436,345 M238K probably benign Het
Lin28b A T 10: 45,469,148 H27Q probably benign Het
Mgat4c A T 10: 102,378,209 R18* probably null Het
Myct1 C A 10: 5,604,492 H120N probably damaging Het
Nek1 A T 8: 61,106,795 D984V probably benign Het
Nfu1 A T 6: 87,009,881 probably benign Het
Nipsnap1 A T 11: 4,883,366 probably null Het
Nlrp9c A G 7: 26,385,621 Y178H probably damaging Het
Nrxn3 T A 12: 89,510,607 M520K probably damaging Het
Oacyl A G 18: 65,720,252 D143G probably benign Het
Obox5 A G 7: 15,758,807 Y229C probably damaging Het
Olfr340 A G 2: 36,452,690 Y35C probably damaging Het
Olfr347 G A 2: 36,734,424 M34I probably benign Het
Olfr448 T C 6: 42,897,090 V213A probably damaging Het
Olfr669 T C 7: 104,939,198 L224P probably damaging Het
Otogl C T 10: 107,866,654 A713T probably benign Het
Pcdhb17 A C 18: 37,486,513 N452T probably benign Het
Pi16 A G 17: 29,326,339 Y192C probably damaging Het
Pla2g5 T C 4: 138,804,519 D58G probably damaging Het
Plpp4 G T 7: 129,379,483 V153F unknown Het
Plxna2 C A 1: 194,644,568 S270* probably null Het
Pole T A 5: 110,325,102 probably null Het
Prmt7 T C 8: 106,235,100 F215S unknown Het
Ptpn21 C T 12: 98,688,912 V599I probably damaging Het
Rab26 C A 17: 24,530,678 R131L probably damaging Het
Raph1 A T 1: 60,525,977 V117D probably benign Het
Sacs T C 14: 61,210,396 V3297A probably damaging Het
Serpine1 C A 5: 137,066,942 A262S probably benign Het
Sgf29 A G 7: 126,672,049 D193G probably null Het
Sh3rf2 G A 18: 42,104,162 probably null Het
Sipa1l1 T C 12: 82,422,462 V1245A possibly damaging Het
Slc22a7 A G 17: 46,438,298 L31P probably damaging Het
Slc24a5 G A 2: 125,088,191 V471I probably benign Het
Slc26a7 A T 4: 14,533,639 Y395N probably damaging Het
Slc38a2 T C 15: 96,693,301 M229V probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Susd1 G A 4: 59,411,318 R225* probably null Het
Suz12 T A 11: 79,993,593 F92I probably damaging Het
Tmem114 C A 16: 8,424,746 probably benign Het
Tmem68 A G 4: 3,564,107 V159A probably benign Het
Tpra1 T A 6: 88,908,294 I76N probably damaging Het
Trim45 A G 3: 100,932,037 T752A unknown Het
Trp63 C A 16: 25,820,477 H138Q probably damaging Het
Ugt2a2 T C 5: 87,460,396 D528G possibly damaging Het
Vmn2r39 T G 7: 9,014,762 K858N possibly damaging Het
Zfp629 A T 7: 127,611,312 S442T probably damaging Het
Other mutations in Hic1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01110:Hic1 APN 11 75165519 missense possibly damaging 0.96
cough UTSW 11 75166317 missense possibly damaging 0.93
Cup UTSW 11 75167374 missense probably damaging 0.97
Undulate UTSW 11 75166216 missense possibly damaging 0.96
R0138:Hic1 UTSW 11 75167343 missense probably damaging 0.99
R0331:Hic1 UTSW 11 75165490 missense possibly damaging 0.53
R0491:Hic1 UTSW 11 75166310 missense possibly damaging 0.86
R0521:Hic1 UTSW 11 75166887 missense possibly damaging 0.68
R0744:Hic1 UTSW 11 75165801 missense possibly damaging 0.52
R1766:Hic1 UTSW 11 75165794 nonsense probably null
R2070:Hic1 UTSW 11 75169059 missense possibly damaging 0.68
R2211:Hic1 UTSW 11 75169384 missense possibly damaging 0.59
R5418:Hic1 UTSW 11 75166599 splice site probably null
R6047:Hic1 UTSW 11 75166849 missense possibly damaging 0.94
R6076:Hic1 UTSW 11 75167328 missense probably damaging 1.00
R6415:Hic1 UTSW 11 75166317 missense possibly damaging 0.93
R6633:Hic1 UTSW 11 75169498 missense unknown
R7308:Hic1 UTSW 11 75167151 missense probably damaging 1.00
R7761:Hic1 UTSW 11 75167374 missense probably damaging 0.97
R7778:Hic1 UTSW 11 75166216 missense possibly damaging 0.96
R7824:Hic1 UTSW 11 75166216 missense possibly damaging 0.96
R8230:Hic1 UTSW 11 75165585 missense possibly damaging 0.85
R8419:Hic1 UTSW 11 75166270 missense possibly damaging 0.96
RF029:Hic1 UTSW 11 75169442 small deletion probably benign
RF043:Hic1 UTSW 11 75169455 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AGGGAAGACACTTAGAGCCC -3'
(R):5'- TATGTACTCGGGAGCACTCAG -3'

Sequencing Primer
(F):5'- GCACGAGGACCAGATTGTC -3'
(R):5'- TCAGCACAAAACCCCCAGG -3'
Posted On2019-05-15