Incidental Mutation 'R0599:Fry'
ID55210
Institutional Source Beutler Lab
Gene Symbol Fry
Ensembl Gene ENSMUSG00000056602
Gene NameFRY microtubule binding protein
Synonyms9330186A19Rik, cg003
MMRRC Submission 038788-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.636) question?
Stock #R0599 (G1)
Quality Score211
Status Validated
Chromosome5
Chromosomal Location150118645-150497753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 150437159 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 2090 (R2090Q)
Ref Sequence ENSEMBL: ENSMUSP00000084454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087204] [ENSMUST00000202566]
Predicted Effect probably damaging
Transcript: ENSMUST00000087204
AA Change: R2090Q

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000084454
Gene: ENSMUSG00000056602
AA Change: R2090Q

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 165 697 5.3e-170 PFAM
low complexity region 1014 1040 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1188 1380 1.2e-15 PFAM
Pfam:MOR2-PAG1_mid 1398 1534 1.5e-5 PFAM
Pfam:MOR2-PAG1_mid 1632 1704 1.8e-7 PFAM
Pfam:MOR2-PAG1_mid 1772 1906 4.9e-10 PFAM
low complexity region 1936 1956 N/A INTRINSIC
low complexity region 1962 1980 N/A INTRINSIC
Pfam:MOR2-PAG1_C 2050 2303 1.9e-74 PFAM
low complexity region 2369 2385 N/A INTRINSIC
low complexity region 2463 2482 N/A INTRINSIC
low complexity region 2525 2534 N/A INTRINSIC
low complexity region 2836 2852 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000202566
AA Change: R77Q

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144657
Gene: ENSMUSG00000056602
AA Change: R77Q

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_C 37 290 1.5e-71 PFAM
low complexity region 356 372 N/A INTRINSIC
low complexity region 447 472 N/A INTRINSIC
low complexity region 515 524 N/A INTRINSIC
low complexity region 832 848 N/A INTRINSIC
Meta Mutation Damage Score 0.0716 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 98% (80/82)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,552,245 L978P probably damaging Het
Abcb1a C T 5: 8,698,539 T290M probably benign Het
Abcd3 A T 3: 121,765,093 F585I probably damaging Het
Acan A G 7: 79,111,290 probably benign Het
Anxa6 T C 11: 54,979,466 D667G possibly damaging Het
Ap3m2 G T 8: 22,793,112 A208D possibly damaging Het
Arhgap17 A T 7: 123,303,790 probably benign Het
Bptf A G 11: 107,068,382 V1838A probably damaging Het
Brip1 T A 11: 86,152,737 M334L probably benign Het
Btbd10 C T 7: 113,335,309 probably benign Het
Btbd11 G A 10: 85,658,336 G1106D probably damaging Het
Cdh7 C A 1: 110,052,966 T208K probably damaging Het
Cnga4 A G 7: 105,405,818 Y100C probably damaging Het
Dnah10 G A 5: 124,800,953 V2644M probably damaging Het
Dnah9 T C 11: 65,965,689 D2882G probably damaging Het
Eapp T A 12: 54,685,962 K117M probably damaging Het
Eml3 T C 19: 8,939,063 V673A probably benign Het
Ephb4 G A 5: 137,369,855 C754Y probably damaging Het
Eps8l1 A G 7: 4,477,957 D33G possibly damaging Het
Farsa A G 8: 84,867,583 K321E probably damaging Het
Gm10283 A G 8: 60,501,224 probably benign Het
Grm4 A G 17: 27,431,490 I844T probably benign Het
Gtf2h3 A G 5: 124,588,628 D124G probably benign Het
Gulo A T 14: 65,990,441 D347E probably damaging Het
Hmcn1 A G 1: 150,609,801 F4350S possibly damaging Het
Hspg2 A G 4: 137,512,401 D473G probably damaging Het
Il17ra T A 6: 120,481,505 I539N probably damaging Het
Insrr A G 3: 87,813,133 E1026G probably damaging Het
Itga2 A T 13: 114,856,650 probably benign Het
Kdm1b A T 13: 47,058,810 D190V possibly damaging Het
Lima1 A T 15: 99,802,159 N146K probably damaging Het
Mettl7a3 A T 15: 100,335,383 N152Y possibly damaging Het
Mnt G T 11: 74,842,296 V85L probably benign Het
Mon2 T A 10: 123,026,065 probably benign Het
Mtf1 T C 4: 124,820,201 probably benign Het
Mylk4 T C 13: 32,712,754 probably null Het
Myo18b A C 5: 112,865,750 L780R probably damaging Het
Myo1e A G 9: 70,376,660 probably benign Het
Obscn A G 11: 59,073,696 S705P probably damaging Het
Ocrl A T X: 47,936,086 probably benign Het
Olfr1260 T C 2: 89,978,201 F141S probably benign Het
Olfr394 A T 11: 73,887,904 M156K probably benign Het
Olfr599 A G 7: 103,338,186 N44S probably damaging Het
Olfr639 A T 7: 104,012,188 C171* probably null Het
Otof T A 5: 30,370,705 K1931N probably damaging Het
Plcxd3 A G 15: 4,516,867 S118G probably damaging Het
Plcz1 T A 6: 140,028,542 Q58L probably benign Het
Proser1 C A 3: 53,479,064 P789Q probably benign Het
Rassf4 T C 6: 116,645,936 E38G probably damaging Het
Ros1 A T 10: 52,123,300 Y1164N probably damaging Het
Rpgrip1l A G 8: 91,305,000 I83T probably damaging Het
Scn9a T G 2: 66,526,799 K1053Q probably damaging Het
Sgsm1 G T 5: 113,245,028 Q1087K probably damaging Het
Slc16a10 T C 10: 40,141,918 D40G probably benign Het
Slc27a6 A G 18: 58,556,813 D117G probably damaging Het
Slc2a9 T A 5: 38,480,144 probably benign Het
Slc4a1 A G 11: 102,357,915 probably benign Het
Smarca1 T A X: 47,823,426 Q982L probably benign Het
Sp100 T A 1: 85,681,110 I320N possibly damaging Het
Stx8 A T 11: 68,109,362 R209S probably null Het
Sulf2 T C 2: 166,083,879 T453A possibly damaging Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tenm2 T A 11: 36,024,780 I1976F possibly damaging Het
Tenm3 G A 8: 48,277,710 S1341L probably damaging Het
Tmem130 C T 5: 144,737,809 V369M probably damaging Het
Tmem200c A G 17: 68,840,511 K30E probably damaging Het
Tmem225 A G 9: 40,149,747 I117V possibly damaging Het
Top2a A G 11: 99,001,417 I1073T probably damaging Het
Trps1 A C 15: 50,831,860 Y296* probably null Het
Tubg1 T C 11: 101,125,336 M377T probably benign Het
Vmn1r35 G A 6: 66,679,513 H58Y probably benign Het
Vmn1r56 G A 7: 5,196,430 H63Y probably benign Het
Vmn1r75 T C 7: 11,881,262 probably null Het
Vnn3 T C 10: 23,865,705 S303P possibly damaging Het
Wdr49 C T 3: 75,431,076 probably null Het
Wdr49 T C 3: 75,449,890 probably null Het
Zcchc6 A G 13: 59,809,487 V7A probably damaging Het
Zzef1 T C 11: 72,913,178 L2582P probably damaging Het
Other mutations in Fry
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Fry APN 5 150340404 nonsense probably null
IGL00328:Fry APN 5 150340404 nonsense probably null
IGL00841:Fry APN 5 150422724 missense probably benign
IGL00938:Fry APN 5 150370180 missense probably damaging 1.00
IGL01015:Fry APN 5 150422787 missense probably benign 0.18
IGL01401:Fry APN 5 150438788 missense probably benign
IGL01616:Fry APN 5 150399599 missense probably damaging 1.00
IGL01616:Fry APN 5 150438811 splice site probably null
IGL01748:Fry APN 5 150345651 splice site probably benign
IGL01965:Fry APN 5 150381621 missense probably damaging 1.00
IGL02030:Fry APN 5 150471618 splice site probably benign
IGL02079:Fry APN 5 150399624 missense probably damaging 0.97
IGL02087:Fry APN 5 150403594 missense probably benign 0.23
IGL02113:Fry APN 5 150399605 missense probably benign
IGL02209:Fry APN 5 150437026 missense probably benign 0.00
IGL02250:Fry APN 5 150403434 splice site probably benign
IGL02265:Fry APN 5 150437153 missense probably damaging 1.00
IGL02486:Fry APN 5 150491177 missense probably damaging 0.99
IGL02552:Fry APN 5 150380910 missense probably damaging 1.00
IGL02881:Fry APN 5 150359051 missense probably damaging 0.99
IGL03008:Fry APN 5 150345556 missense possibly damaging 0.82
IGL03140:Fry APN 5 150495701 missense probably damaging 0.98
IGL03171:Fry APN 5 150380809 missense probably damaging 1.00
IGL03389:Fry APN 5 150394231 missense probably damaging 1.00
IGL03404:Fry APN 5 150326168 missense probably damaging 1.00
Brook UTSW 5 150326132 missense probably damaging 1.00
miracle UTSW 5 150437159 missense probably damaging 0.99
quickening UTSW 5 150434776 missense probably damaging 1.00
seasons UTSW 5 150466437 missense probably benign 0.06
R0023:Fry UTSW 5 150451098 missense possibly damaging 0.78
R0024:Fry UTSW 5 150380803 missense probably benign 0.03
R0030:Fry UTSW 5 150372569 nonsense probably null
R0053:Fry UTSW 5 150461377 splice site probably benign
R0089:Fry UTSW 5 150340427 missense possibly damaging 0.91
R0212:Fry UTSW 5 150496397 missense probably damaging 0.99
R0241:Fry UTSW 5 150260346 intron probably benign
R0265:Fry UTSW 5 150434776 missense probably damaging 1.00
R0317:Fry UTSW 5 150471468 missense probably damaging 1.00
R0532:Fry UTSW 5 150433707 unclassified probably benign
R0532:Fry UTSW 5 150478761 splice site probably benign
R0631:Fry UTSW 5 150496352 missense possibly damaging 0.82
R0723:Fry UTSW 5 150496360 missense probably damaging 1.00
R0766:Fry UTSW 5 150403432 splice site probably benign
R0790:Fry UTSW 5 150466437 missense probably benign 0.06
R0928:Fry UTSW 5 150437084 missense probably damaging 1.00
R1104:Fry UTSW 5 150496289 missense probably damaging 1.00
R1144:Fry UTSW 5 150418464 missense possibly damaging 0.94
R1172:Fry UTSW 5 150481494 nonsense probably null
R1312:Fry UTSW 5 150403432 splice site probably benign
R1347:Fry UTSW 5 150495818 missense probably damaging 1.00
R1347:Fry UTSW 5 150495818 missense probably damaging 1.00
R1437:Fry UTSW 5 150310425 missense possibly damaging 0.92
R1458:Fry UTSW 5 150380859 missense probably damaging 1.00
R1542:Fry UTSW 5 150404966 missense probably benign 0.13
R1692:Fry UTSW 5 150370227 missense probably damaging 1.00
R1826:Fry UTSW 5 150436709 missense possibly damaging 0.82
R1874:Fry UTSW 5 150345921 missense probably damaging 1.00
R1875:Fry UTSW 5 150326132 missense probably damaging 1.00
R1881:Fry UTSW 5 150478046 missense probably damaging 0.97
R1884:Fry UTSW 5 150403520 missense probably benign 0.00
R1929:Fry UTSW 5 150400924 missense probably null 0.02
R2066:Fry UTSW 5 150370119 splice site probably benign
R2270:Fry UTSW 5 150400924 missense probably null 0.02
R2356:Fry UTSW 5 150471432 missense probably benign
R3720:Fry UTSW 5 150454572 missense probably damaging 1.00
R3773:Fry UTSW 5 150398198 missense probably damaging 0.96
R3824:Fry UTSW 5 150496419 missense possibly damaging 0.94
R3902:Fry UTSW 5 150345927 missense probably damaging 1.00
R3923:Fry UTSW 5 150413349 missense probably benign
R4250:Fry UTSW 5 150310360 missense probably damaging 0.99
R4332:Fry UTSW 5 150381663 missense probably damaging 1.00
R4495:Fry UTSW 5 150310463 missense probably damaging 1.00
R4610:Fry UTSW 5 150386104 missense probably damaging 1.00
R4682:Fry UTSW 5 150422754 missense probably damaging 1.00
R4732:Fry UTSW 5 150386007 missense possibly damaging 0.93
R4733:Fry UTSW 5 150386007 missense possibly damaging 0.93
R4755:Fry UTSW 5 150398254 missense probably damaging 0.99
R4788:Fry UTSW 5 150399636 missense probably benign 0.00
R4803:Fry UTSW 5 150399533 missense probably benign 0.31
R4858:Fry UTSW 5 150401643 missense possibly damaging 0.78
R4872:Fry UTSW 5 150394239 critical splice donor site probably null
R4902:Fry UTSW 5 150495703 missense probably benign 0.43
R4915:Fry UTSW 5 150478863 missense probably benign 0.30
R4938:Fry UTSW 5 150477989 missense probably damaging 1.00
R4983:Fry UTSW 5 150398254 missense probably damaging 1.00
R5004:Fry UTSW 5 150433604 missense probably benign 0.16
R5040:Fry UTSW 5 150388854 missense probably damaging 0.99
R5145:Fry UTSW 5 150370224 missense probably damaging 0.98
R5170:Fry UTSW 5 150429854 missense probably benign 0.03
R5233:Fry UTSW 5 150469720 missense possibly damaging 0.71
R5428:Fry UTSW 5 150405359 missense possibly damaging 0.89
R5468:Fry UTSW 5 150399588 missense probably benign 0.44
R5481:Fry UTSW 5 150260319 missense probably benign 0.01
R5494:Fry UTSW 5 150390667 missense probably damaging 1.00
R5538:Fry UTSW 5 150495848 missense probably damaging 1.00
R5638:Fry UTSW 5 150359081 missense possibly damaging 0.46
R5645:Fry UTSW 5 150380867 missense probably damaging 1.00
R5716:Fry UTSW 5 150370221 nonsense probably null
R5812:Fry UTSW 5 150399671 missense probably damaging 0.99
R5813:Fry UTSW 5 150399671 missense probably damaging 0.99
R5873:Fry UTSW 5 150378885 missense probably damaging 1.00
R5933:Fry UTSW 5 150390800 intron probably benign
R6037:Fry UTSW 5 150428179 missense probably benign 0.03
R6037:Fry UTSW 5 150428179 missense probably benign 0.03
R6158:Fry UTSW 5 150454572 missense probably damaging 1.00
R6178:Fry UTSW 5 150454522 missense probably damaging 1.00
R6481:Fry UTSW 5 150386014 missense probably damaging 1.00
R6562:Fry UTSW 5 150326149 missense probably damaging 1.00
R6676:Fry UTSW 5 150380922 missense probably benign 0.22
R6717:Fry UTSW 5 150496312 missense probably benign 0.00
R6828:Fry UTSW 5 150466446 splice site probably null
R6874:Fry UTSW 5 150437303 missense probably benign 0.00
R6930:Fry UTSW 5 150428230 missense probably benign 0.00
R6963:Fry UTSW 5 150457844 missense probably benign 0.17
R6965:Fry UTSW 5 150416220 missense possibly damaging 0.79
R7051:Fry UTSW 5 150395169 missense possibly damaging 0.93
R7085:Fry UTSW 5 150438749 missense probably benign 0.02
R7108:Fry UTSW 5 150395786 missense probably damaging 1.00
R7108:Fry UTSW 5 150491090 missense
R7115:Fry UTSW 5 150386067 missense probably damaging 1.00
R7116:Fry UTSW 5 150395869 critical splice donor site probably null
R7197:Fry UTSW 5 150469767 missense
R7256:Fry UTSW 5 150466786 missense
R7318:Fry UTSW 5 150436993 missense probably damaging 0.98
R7323:Fry UTSW 5 150496349 missense
R7358:Fry UTSW 5 150416323 missense probably benign
R7361:Fry UTSW 5 150436847 missense possibly damaging 0.92
R7395:Fry UTSW 5 150380883 missense possibly damaging 0.82
R7487:Fry UTSW 5 150414574 missense possibly damaging 0.79
R7491:Fry UTSW 5 150466326 missense
R7574:Fry UTSW 5 150380894 missense probably benign 0.00
R7582:Fry UTSW 5 150496382 missense
R7586:Fry UTSW 5 150426218 missense probably damaging 1.00
R7650:Fry UTSW 5 150413418 missense probably damaging 1.00
R7699:Fry UTSW 5 150405327 missense probably damaging 0.98
R7700:Fry UTSW 5 150405327 missense probably damaging 0.98
R7972:Fry UTSW 5 150310396 missense probably benign 0.05
R8058:Fry UTSW 5 150495767 missense
R8070:Fry UTSW 5 150478007 missense
R8159:Fry UTSW 5 150399533 missense probably benign 0.31
R8202:Fry UTSW 5 150431737 missense probably damaging 1.00
R8261:Fry UTSW 5 150445907 missense probably damaging 1.00
R8279:Fry UTSW 5 150496261 missense
R8338:Fry UTSW 5 150359051 missense probably damaging 0.99
R8370:Fry UTSW 5 150395819 missense probably damaging 1.00
Z1177:Fry UTSW 5 150310437 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CCAGAAGCAATTCCTCCCTGAAGG -3'
(R):5'- TCTCTAAAGCTGAATGCAGCCACC -3'

Sequencing Primer
(F):5'- ATTCCTCCCTGAAGGAGAGC -3'
(R):5'- CCAACAGGTCTACAGGCAGTG -3'
Posted On2013-07-11