Incidental Mutation 'R7122:Ptpn21'
ID552100
Institutional Source Beutler Lab
Gene Symbol Ptpn21
Ensembl Gene ENSMUSG00000021009
Gene Nameprotein tyrosine phosphatase, non-receptor type 21
SynonymsPTPD1, PTPRL10
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R7122 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location98676741-98737405 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 98688912 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 599 (V599I)
Ref Sequence ENSEMBL: ENSMUSP00000082197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085116] [ENSMUST00000170188] [ENSMUST00000221148] [ENSMUST00000221535] [ENSMUST00000221932]
Predicted Effect probably damaging
Transcript: ENSMUST00000085116
AA Change: V599I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000082197
Gene: ENSMUSG00000021009
AA Change: V599I

DomainStartEndE-ValueType
B41 19 222 5.04e-69 SMART
FERM_C 226 312 4.66e-26 SMART
low complexity region 332 343 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
PTPc 897 1171 7.31e-111 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170188
AA Change: V599I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126975
Gene: ENSMUSG00000021009
AA Change: V599I

DomainStartEndE-ValueType
B41 19 222 5.04e-69 SMART
FERM_C 226 312 4.66e-26 SMART
low complexity region 332 343 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
PTPc 897 1171 7.31e-111 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221148
Predicted Effect probably benign
Transcript: ENSMUST00000221535
Predicted Effect probably damaging
Transcript: ENSMUST00000221932
AA Change: V599I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an N-terminal domain, similar to cytoskeletal- associated proteins including band 4.1, ezrin, merlin, and radixin. This PTP was shown to specially interact with BMX/ETK, a member of Tec tyrosine kinase family characterized by a multimodular structures including PH, SH3, and SH2 domains. The interaction of this PTP with BMX kinase was found to increase the activation of STAT3, but not STAT2 kinase. Studies of the similar gene in mice suggested the possible roles of this PTP in liver regeneration and spermatogenesis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 T A 13: 4,511,276 E126V probably benign Het
Alg3 A T 16: 20,607,852 L213H probably damaging Het
Atp1a4 T A 1: 172,231,936 Y863F possibly damaging Het
Atp6v0e A G 17: 26,695,416 T72A probably benign Het
Aup1 A G 6: 83,055,142 T97A probably benign Het
Bcl6 T C 16: 23,972,902 D234G probably damaging Het
Cdc42bpa T C 1: 180,065,018 L249P probably damaging Het
Celsr3 A G 9: 108,828,567 K750E possibly damaging Het
Ces1g C A 8: 93,317,037 G425C possibly damaging Het
Chl1 T C 6: 103,706,448 L745P probably damaging Het
Csmd2 G A 4: 128,449,227 V1471M Het
Dnah12 G A 14: 26,778,912 probably null Het
E330017A01Rik C A 16: 58,637,777 A54S probably benign Het
E4f1 G A 17: 24,444,834 Q569* probably null Het
Fbxw24 A T 9: 109,601,260 C439S probably benign Het
Gm11639 A T 11: 105,008,961 I4350F possibly damaging Het
Gmip C T 8: 69,817,802 P721S probably benign Het
Grip1 A G 10: 120,035,374 I669V possibly damaging Het
Gsn A T 2: 35,295,049 K339* probably null Het
Herc1 G T 9: 66,399,774 A959S possibly damaging Het
Hic1 A G 11: 75,169,230 V97A probably benign Het
Il11ra1 A G 4: 41,766,189 Y242C probably damaging Het
Iqsec3 A C 6: 121,473,358 V69G unknown Het
Jak3 T A 8: 71,685,957 M933K probably damaging Het
Kbtbd7 G A 14: 79,428,317 V530I probably damaging Het
Kif22 G A 7: 127,032,978 R345C probably benign Het
Klhl7 G A 5: 24,138,435 E250K probably damaging Het
Klk1b4 A G 7: 44,211,107 H183R probably damaging Het
Lhfpl4 C T 6: 113,176,671 V140I probably benign Het
Lhx5 T A 5: 120,436,345 M238K probably benign Het
Lin28b A T 10: 45,469,148 H27Q probably benign Het
Mgat4c A T 10: 102,378,209 R18* probably null Het
Myct1 C A 10: 5,604,492 H120N probably damaging Het
Nek1 A T 8: 61,106,795 D984V probably benign Het
Nfu1 A T 6: 87,009,881 probably benign Het
Nipsnap1 A T 11: 4,883,366 probably null Het
Nlrp9c A G 7: 26,385,621 Y178H probably damaging Het
Nrxn3 T A 12: 89,510,607 M520K probably damaging Het
Oacyl A G 18: 65,720,252 D143G probably benign Het
Obox5 A G 7: 15,758,807 Y229C probably damaging Het
Olfr340 A G 2: 36,452,690 Y35C probably damaging Het
Olfr347 G A 2: 36,734,424 M34I probably benign Het
Olfr448 T C 6: 42,897,090 V213A probably damaging Het
Olfr669 T C 7: 104,939,198 L224P probably damaging Het
Otogl C T 10: 107,866,654 A713T probably benign Het
Pcdhb17 A C 18: 37,486,513 N452T probably benign Het
Pi16 A G 17: 29,326,339 Y192C probably damaging Het
Pla2g5 T C 4: 138,804,519 D58G probably damaging Het
Plpp4 G T 7: 129,379,483 V153F unknown Het
Plxna2 C A 1: 194,644,568 S270* probably null Het
Pole T A 5: 110,325,102 probably null Het
Prmt7 T C 8: 106,235,100 F215S unknown Het
Rab26 C A 17: 24,530,678 R131L probably damaging Het
Raph1 A T 1: 60,525,977 V117D probably benign Het
Sacs T C 14: 61,210,396 V3297A probably damaging Het
Serpine1 C A 5: 137,066,942 A262S probably benign Het
Sgf29 A G 7: 126,672,049 D193G probably null Het
Sh3rf2 G A 18: 42,104,162 probably null Het
Sipa1l1 T C 12: 82,422,462 V1245A possibly damaging Het
Slc22a7 A G 17: 46,438,298 L31P probably damaging Het
Slc24a5 G A 2: 125,088,191 V471I probably benign Het
Slc26a7 A T 4: 14,533,639 Y395N probably damaging Het
Slc38a2 T C 15: 96,693,301 M229V probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Susd1 G A 4: 59,411,318 R225* probably null Het
Suz12 T A 11: 79,993,593 F92I probably damaging Het
Tmem114 C A 16: 8,424,746 probably benign Het
Tmem68 A G 4: 3,564,107 V159A probably benign Het
Tpra1 T A 6: 88,908,294 I76N probably damaging Het
Trim45 A G 3: 100,932,037 T752A unknown Het
Trp63 C A 16: 25,820,477 H138Q probably damaging Het
Ugt2a2 T C 5: 87,460,396 D528G possibly damaging Het
Vmn2r39 T G 7: 9,014,762 K858N possibly damaging Het
Zfp629 A T 7: 127,611,312 S442T probably damaging Het
Other mutations in Ptpn21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Ptpn21 APN 12 98680468 missense probably damaging 1.00
IGL00576:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00577:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00580:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00583:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00773:Ptpn21 APN 12 98688313 missense probably benign 0.00
IGL00780:Ptpn21 APN 12 98680371 missense probably damaging 1.00
IGL01516:Ptpn21 APN 12 98715189 missense probably damaging 1.00
IGL01616:Ptpn21 APN 12 98680013 missense probably damaging 1.00
IGL01939:Ptpn21 APN 12 98689161 missense probably damaging 0.96
IGL02237:Ptpn21 APN 12 98705092 critical splice donor site probably null
IGL02512:Ptpn21 APN 12 98679392 missense probably benign 0.00
IGL02852:Ptpn21 APN 12 98715195 critical splice acceptor site probably null
IGL02894:Ptpn21 APN 12 98689632 splice site probably benign
IGL03024:Ptpn21 APN 12 98680056 missense probably benign
IGL03220:Ptpn21 APN 12 98678623 missense probably damaging 1.00
R0144:Ptpn21 UTSW 12 98688609 missense probably benign 0.01
R0472:Ptpn21 UTSW 12 98704240 splice site probably benign
R0675:Ptpn21 UTSW 12 98688216 missense probably benign 0.16
R0771:Ptpn21 UTSW 12 98689080 missense probably damaging 1.00
R1434:Ptpn21 UTSW 12 98688590 missense probably damaging 1.00
R1470:Ptpn21 UTSW 12 98688476 missense probably benign
R1470:Ptpn21 UTSW 12 98688476 missense probably benign
R1837:Ptpn21 UTSW 12 98733626 missense probably damaging 0.99
R1897:Ptpn21 UTSW 12 98680405 unclassified probably null
R2048:Ptpn21 UTSW 12 98689526 missense possibly damaging 0.94
R2376:Ptpn21 UTSW 12 98688314 missense possibly damaging 0.62
R3709:Ptpn21 UTSW 12 98688541 missense probably benign
R4197:Ptpn21 UTSW 12 98680138 missense probably damaging 1.00
R4283:Ptpn21 UTSW 12 98733475 missense probably damaging 0.99
R4368:Ptpn21 UTSW 12 98678593 missense probably damaging 1.00
R4397:Ptpn21 UTSW 12 98688248 missense probably damaging 1.00
R4397:Ptpn21 UTSW 12 98715060 missense probably damaging 0.98
R4703:Ptpn21 UTSW 12 98679392 missense probably benign 0.00
R4737:Ptpn21 UTSW 12 98708844 missense probably benign 0.03
R4829:Ptpn21 UTSW 12 98689296 missense probably damaging 1.00
R4926:Ptpn21 UTSW 12 98715195 critical splice acceptor site probably null
R4974:Ptpn21 UTSW 12 98680103 missense probably damaging 1.00
R5022:Ptpn21 UTSW 12 98679407 missense probably damaging 1.00
R5057:Ptpn21 UTSW 12 98679407 missense probably damaging 1.00
R5395:Ptpn21 UTSW 12 98715117 missense probably damaging 1.00
R5608:Ptpn21 UTSW 12 98688777 missense probably benign 0.00
R5741:Ptpn21 UTSW 12 98679289 missense probably damaging 1.00
R5785:Ptpn21 UTSW 12 98682550 missense probably damaging 0.99
R5959:Ptpn21 UTSW 12 98708889 splice site probably null
R5968:Ptpn21 UTSW 12 98710890 missense probably damaging 1.00
R5984:Ptpn21 UTSW 12 98689076 missense probably damaging 1.00
R6005:Ptpn21 UTSW 12 98678552 makesense probably null
R6181:Ptpn21 UTSW 12 98699999 missense probably damaging 0.99
R6226:Ptpn21 UTSW 12 98680116 missense probably benign 0.24
R6226:Ptpn21 UTSW 12 98715172 missense probably damaging 1.00
R6317:Ptpn21 UTSW 12 98689262 missense probably damaging 1.00
R6370:Ptpn21 UTSW 12 98689034 missense possibly damaging 0.86
R6485:Ptpn21 UTSW 12 98698872 nonsense probably null
R6894:Ptpn21 UTSW 12 98715181 missense probably damaging 1.00
R7232:Ptpn21 UTSW 12 98688737 missense probably benign 0.17
R7289:Ptpn21 UTSW 12 98704191 missense probably benign 0.35
R7327:Ptpn21 UTSW 12 98680101 missense probably damaging 1.00
R7474:Ptpn21 UTSW 12 98737363 critical splice donor site probably null
R7748:Ptpn21 UTSW 12 98688772 missense probably benign 0.01
R7816:Ptpn21 UTSW 12 98682532 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGTCAGAGAAGACGCTGG -3'
(R):5'- AACTGACAAATGTGCAGCTGC -3'

Sequencing Primer
(F):5'- TCTGCTGCTGAGGCTGACAC -3'
(R):5'- TGCAGGCTCAGGACTACC -3'
Posted On2019-05-15