Incidental Mutation 'R7122:Slc22a7'
ID552114
Institutional Source Beutler Lab
Gene Symbol Slc22a7
Ensembl Gene ENSMUSG00000067144
Gene Namesolute carrier family 22 (organic anion transporter), member 7
SynonymsNLT, OAT2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R7122 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location46432185-46438477 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46438298 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 31 (L31P)
Ref Sequence ENSEMBL: ENSMUSP00000084234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047034] [ENSMUST00000087012] [ENSMUST00000166852]
Predicted Effect probably benign
Transcript: ENSMUST00000047034
SMART Domains Protein: ENSMUSP00000044580
Gene: ENSMUSG00000015599

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 34 293 3.4e-21 PFAM
Pfam:Pkinase 34 305 1.7e-33 PFAM
low complexity region 320 334 N/A INTRINSIC
low complexity region 371 395 N/A INTRINSIC
low complexity region 570 593 N/A INTRINSIC
low complexity region 611 624 N/A INTRINSIC
low complexity region 633 653 N/A INTRINSIC
low complexity region 697 709 N/A INTRINSIC
coiled coil region 729 776 N/A INTRINSIC
low complexity region 779 797 N/A INTRINSIC
low complexity region 893 913 N/A INTRINSIC
low complexity region 945 962 N/A INTRINSIC
low complexity region 1090 1115 N/A INTRINSIC
low complexity region 1236 1251 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000087012
AA Change: L31P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084234
Gene: ENSMUSG00000067144
AA Change: L31P

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:MFS_1 82 479 1.2e-32 PFAM
Pfam:Sugar_tr 86 524 2.5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166852
SMART Domains Protein: ENSMUSP00000127966
Gene: ENSMUSG00000091742

DomainStartEndE-ValueType
Pfam:Ribosomal_L5 10 59 4.1e-18 PFAM
Pfam:Ribosomal_L5_C 63 161 8.7e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the sodium-independent transport and excretion of organic anions, some of which are potentially toxic. The encoded protein is an integral membrane protein and appears to be localized to the basolateral membrane of the kidney. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 T A 13: 4,511,276 E126V probably benign Het
Alg3 A T 16: 20,607,852 L213H probably damaging Het
Atp1a4 T A 1: 172,231,936 Y863F possibly damaging Het
Atp6v0e A G 17: 26,695,416 T72A probably benign Het
Aup1 A G 6: 83,055,142 T97A probably benign Het
Bcl6 T C 16: 23,972,902 D234G probably damaging Het
Cdc42bpa T C 1: 180,065,018 L249P probably damaging Het
Celsr3 A G 9: 108,828,567 K750E possibly damaging Het
Ces1g C A 8: 93,317,037 G425C possibly damaging Het
Chl1 T C 6: 103,706,448 L745P probably damaging Het
Csmd2 G A 4: 128,449,227 V1471M Het
Dnah12 G A 14: 26,778,912 probably null Het
E330017A01Rik C A 16: 58,637,777 A54S probably benign Het
E4f1 G A 17: 24,444,834 Q569* probably null Het
Fbxw24 A T 9: 109,601,260 C439S probably benign Het
Gm11639 A T 11: 105,008,961 I4350F possibly damaging Het
Gmip C T 8: 69,817,802 P721S probably benign Het
Grip1 A G 10: 120,035,374 I669V possibly damaging Het
Gsn A T 2: 35,295,049 K339* probably null Het
Herc1 G T 9: 66,399,774 A959S possibly damaging Het
Hic1 A G 11: 75,169,230 V97A probably benign Het
Il11ra1 A G 4: 41,766,189 Y242C probably damaging Het
Iqsec3 A C 6: 121,473,358 V69G unknown Het
Jak3 T A 8: 71,685,957 M933K probably damaging Het
Kbtbd7 G A 14: 79,428,317 V530I probably damaging Het
Kif22 G A 7: 127,032,978 R345C probably benign Het
Klhl7 G A 5: 24,138,435 E250K probably damaging Het
Klk1b4 A G 7: 44,211,107 H183R probably damaging Het
Lhfpl4 C T 6: 113,176,671 V140I probably benign Het
Lhx5 T A 5: 120,436,345 M238K probably benign Het
Lin28b A T 10: 45,469,148 H27Q probably benign Het
Mgat4c A T 10: 102,378,209 R18* probably null Het
Myct1 C A 10: 5,604,492 H120N probably damaging Het
Nek1 A T 8: 61,106,795 D984V probably benign Het
Nfu1 A T 6: 87,009,881 probably benign Het
Nipsnap1 A T 11: 4,883,366 probably null Het
Nlrp9c A G 7: 26,385,621 Y178H probably damaging Het
Nrxn3 T A 12: 89,510,607 M520K probably damaging Het
Oacyl A G 18: 65,720,252 D143G probably benign Het
Obox5 A G 7: 15,758,807 Y229C probably damaging Het
Olfr340 A G 2: 36,452,690 Y35C probably damaging Het
Olfr347 G A 2: 36,734,424 M34I probably benign Het
Olfr448 T C 6: 42,897,090 V213A probably damaging Het
Olfr669 T C 7: 104,939,198 L224P probably damaging Het
Otogl C T 10: 107,866,654 A713T probably benign Het
Pcdhb17 A C 18: 37,486,513 N452T probably benign Het
Pi16 A G 17: 29,326,339 Y192C probably damaging Het
Pla2g5 T C 4: 138,804,519 D58G probably damaging Het
Plpp4 G T 7: 129,379,483 V153F unknown Het
Plxna2 C A 1: 194,644,568 S270* probably null Het
Pole T A 5: 110,325,102 probably null Het
Prmt7 T C 8: 106,235,100 F215S unknown Het
Ptpn21 C T 12: 98,688,912 V599I probably damaging Het
Rab26 C A 17: 24,530,678 R131L probably damaging Het
Raph1 A T 1: 60,525,977 V117D probably benign Het
Sacs T C 14: 61,210,396 V3297A probably damaging Het
Serpine1 C A 5: 137,066,942 A262S probably benign Het
Sgf29 A G 7: 126,672,049 D193G probably null Het
Sh3rf2 G A 18: 42,104,162 probably null Het
Sipa1l1 T C 12: 82,422,462 V1245A possibly damaging Het
Slc24a5 G A 2: 125,088,191 V471I probably benign Het
Slc26a7 A T 4: 14,533,639 Y395N probably damaging Het
Slc38a2 T C 15: 96,693,301 M229V probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Susd1 G A 4: 59,411,318 R225* probably null Het
Suz12 T A 11: 79,993,593 F92I probably damaging Het
Tmem114 C A 16: 8,424,746 probably benign Het
Tmem68 A G 4: 3,564,107 V159A probably benign Het
Tpra1 T A 6: 88,908,294 I76N probably damaging Het
Trim45 A G 3: 100,932,037 T752A unknown Het
Trp63 C A 16: 25,820,477 H138Q probably damaging Het
Ugt2a2 T C 5: 87,460,396 D528G possibly damaging Het
Vmn2r39 T G 7: 9,014,762 K858N possibly damaging Het
Zfp629 A T 7: 127,611,312 S442T probably damaging Het
Other mutations in Slc22a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01638:Slc22a7 APN 17 46437994 splice site probably null
R0755:Slc22a7 UTSW 17 46438187 missense possibly damaging 0.93
R0898:Slc22a7 UTSW 17 46433149 missense probably damaging 1.00
R1594:Slc22a7 UTSW 17 46438031 missense possibly damaging 0.94
R1794:Slc22a7 UTSW 17 46433153 missense probably damaging 1.00
R1900:Slc22a7 UTSW 17 46438231 missense probably benign 0.00
R1973:Slc22a7 UTSW 17 46437090 missense probably damaging 1.00
R2117:Slc22a7 UTSW 17 46433972 missense possibly damaging 0.55
R4467:Slc22a7 UTSW 17 46432510 missense probably benign
R4739:Slc22a7 UTSW 17 46434997 missense probably damaging 1.00
R4921:Slc22a7 UTSW 17 46436933 missense probably benign 0.00
R6982:Slc22a7 UTSW 17 46434637 missense probably benign 0.02
R7412:Slc22a7 UTSW 17 46434627 missense probably benign 0.00
R7634:Slc22a7 UTSW 17 46438230 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACACCTCTGTTCCCAAGGTG -3'
(R):5'- TGCACTCATCAGTACAACTATTCCC -3'

Sequencing Primer
(F):5'- CTCTGTTCCCAAGGTGACATTGG -3'
(R):5'- CACCTCCAGAGTCCAAGGG -3'
Posted On2019-05-15