Mutagenetix > Incidental Mutations

Incidental Mutation 'R7122:Slc22a7'

552114

Institutional Source

Beutler Lab

Gene Symbol

Slc22a7

Ensembl Gene

ENSMUSG00000067144

Gene Name

solute carrier family 22 (organic anion transporter), member 7

Synonyms

NLT, OAT2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.079) question?

Stock #

R7122 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

46432185-46438477 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 46438298 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 31 (L31P)

Ref Sequence

ENSEMBL: ENSMUSP00000084234 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047034] [ENSMUST00000087012] [ENSMUST00000166852]

Predicted Effect

probably benign
Transcript: ENSMUST00000047034

SMART Domains

Protein: ENSMUSP00000044580
Gene: ENSMUSG00000015599

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	34	293	3.4e-21	PFAM
Pfam:Pkinase	34	305	1.7e-33	PFAM
low complexity region	320	334	N/A	INTRINSIC
low complexity region	371	395	N/A	INTRINSIC
low complexity region	570	593	N/A	INTRINSIC
low complexity region	611	624	N/A	INTRINSIC
low complexity region	633	653	N/A	INTRINSIC
low complexity region	697	709	N/A	INTRINSIC
coiled coil region	729	776	N/A	INTRINSIC
low complexity region	779	797	N/A	INTRINSIC
low complexity region	893	913	N/A	INTRINSIC
low complexity region	945	962	N/A	INTRINSIC
low complexity region	1090	1115	N/A	INTRINSIC
low complexity region	1236	1251	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000087012
AA Change: L31P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000084234
Gene: ENSMUSG00000067144
AA Change: L31P

Domain	Start	End	E-Value	Type
transmembrane domain	21	43	N/A	INTRINSIC
Pfam:MFS_1	82	479	1.2e-32	PFAM
Pfam:Sugar_tr	86	524	2.5e-36	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000166852

SMART Domains

Protein: ENSMUSP00000127966
Gene: ENSMUSG00000091742

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L5	10	59	4.1e-18	PFAM
Pfam:Ribosomal_L5_C	63	161	8.7e-25	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

99% (75/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the sodium-independent transport and excretion of organic anions, some of which are potentially toxic. The encoded protein is an integral membrane protein and appears to be localized to the basolateral membrane of the kidney. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akr1c20	T	A	13: 4,511,276	E126V	probably benign	Het
Alg3	A	T	16: 20,607,852	L213H	probably damaging	Het
Atp1a4	T	A	1: 172,231,936	Y863F	possibly damaging	Het
Atp6v0e	A	G	17: 26,695,416	T72A	probably benign	Het
Aup1	A	G	6: 83,055,142	T97A	probably benign	Het
Bcl6	T	C	16: 23,972,902	D234G	probably damaging	Het
Cdc42bpa	T	C	1: 180,065,018	L249P	probably damaging	Het
Celsr3	A	G	9: 108,828,567	K750E	possibly damaging	Het
Ces1g	C	A	8: 93,317,037	G425C	possibly damaging	Het
Chl1	T	C	6: 103,706,448	L745P	probably damaging	Het
Csmd2	G	A	4: 128,449,227	V1471M		Het
Dnah12	G	A	14: 26,778,912		probably null	Het
E330017A01Rik	C	A	16: 58,637,777	A54S	probably benign	Het
E4f1	G	A	17: 24,444,834	Q569*	probably null	Het
Fbxw24	A	T	9: 109,601,260	C439S	probably benign	Het
Gm11639	A	T	11: 105,008,961	I4350F	possibly damaging	Het
Gmip	C	T	8: 69,817,802	P721S	probably benign	Het
Grip1	A	G	10: 120,035,374	I669V	possibly damaging	Het
Gsn	A	T	2: 35,295,049	K339*	probably null	Het
Herc1	G	T	9: 66,399,774	A959S	possibly damaging	Het
Hic1	A	G	11: 75,169,230	V97A	probably benign	Het
Il11ra1	A	G	4: 41,766,189	Y242C	probably damaging	Het
Iqsec3	A	C	6: 121,473,358	V69G	unknown	Het
Jak3	T	A	8: 71,685,957	M933K	probably damaging	Het
Kbtbd7	G	A	14: 79,428,317	V530I	probably damaging	Het
Kif22	G	A	7: 127,032,978	R345C	probably benign	Het
Klhl7	G	A	5: 24,138,435	E250K	probably damaging	Het
Klk1b4	A	G	7: 44,211,107	H183R	probably damaging	Het
Lhfpl4	C	T	6: 113,176,671	V140I	probably benign	Het
Lhx5	T	A	5: 120,436,345	M238K	probably benign	Het
Lin28b	A	T	10: 45,469,148	H27Q	probably benign	Het
Mgat4c	A	T	10: 102,378,209	R18*	probably null	Het
Myct1	C	A	10: 5,604,492	H120N	probably damaging	Het
Nek1	A	T	8: 61,106,795	D984V	probably benign	Het
Nfu1	A	T	6: 87,009,881		probably benign	Het
Nipsnap1	A	T	11: 4,883,366		probably null	Het
Nlrp9c	A	G	7: 26,385,621	Y178H	probably damaging	Het
Nrxn3	T	A	12: 89,510,607	M520K	probably damaging	Het
Oacyl	A	G	18: 65,720,252	D143G	probably benign	Het
Obox5	A	G	7: 15,758,807	Y229C	probably damaging	Het
Olfr340	A	G	2: 36,452,690	Y35C	probably damaging	Het
Olfr347	G	A	2: 36,734,424	M34I	probably benign	Het
Olfr448	T	C	6: 42,897,090	V213A	probably damaging	Het
Olfr669	T	C	7: 104,939,198	L224P	probably damaging	Het
Otogl	C	T	10: 107,866,654	A713T	probably benign	Het
Pcdhb17	A	C	18: 37,486,513	N452T	probably benign	Het
Pi16	A	G	17: 29,326,339	Y192C	probably damaging	Het
Pla2g5	T	C	4: 138,804,519	D58G	probably damaging	Het
Plpp4	G	T	7: 129,379,483	V153F	unknown	Het
Plxna2	C	A	1: 194,644,568	S270*	probably null	Het
Pole	T	A	5: 110,325,102		probably null	Het
Prmt7	T	C	8: 106,235,100	F215S	unknown	Het
Ptpn21	C	T	12: 98,688,912	V599I	probably damaging	Het
Rab26	C	A	17: 24,530,678	R131L	probably damaging	Het
Raph1	A	T	1: 60,525,977	V117D	probably benign	Het
Sacs	T	C	14: 61,210,396	V3297A	probably damaging	Het
Serpine1	C	A	5: 137,066,942	A262S	probably benign	Het
Sgf29	A	G	7: 126,672,049	D193G	probably null	Het
Sh3rf2	G	A	18: 42,104,162		probably null	Het
Sipa1l1	T	C	12: 82,422,462	V1245A	possibly damaging	Het
Slc24a5	G	A	2: 125,088,191	V471I	probably benign	Het
Slc26a7	A	T	4: 14,533,639	Y395N	probably damaging	Het
Slc38a2	T	C	15: 96,693,301	M229V	probably damaging	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Susd1	G	A	4: 59,411,318	R225*	probably null	Het
Suz12	T	A	11: 79,993,593	F92I	probably damaging	Het
Tmem114	C	A	16: 8,424,746		probably benign	Het
Tmem68	A	G	4: 3,564,107	V159A	probably benign	Het
Tpra1	T	A	6: 88,908,294	I76N	probably damaging	Het
Trim45	A	G	3: 100,932,037	T752A	unknown	Het
Trp63	C	A	16: 25,820,477	H138Q	probably damaging	Het
Ugt2a2	T	C	5: 87,460,396	D528G	possibly damaging	Het
Vmn2r39	T	G	7: 9,014,762	K858N	possibly damaging	Het
Zfp629	A	T	7: 127,611,312	S442T	probably damaging	Het

Other mutations in Slc22a7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01638:Slc22a7	APN	17	46437994	splice site	probably null
R0755:Slc22a7	UTSW	17	46438187	missense	possibly damaging	0.93
R0898:Slc22a7	UTSW	17	46433149	missense	probably damaging	1.00
R1594:Slc22a7	UTSW	17	46438031	missense	possibly damaging	0.94
R1794:Slc22a7	UTSW	17	46433153	missense	probably damaging	1.00
R1900:Slc22a7	UTSW	17	46438231	missense	probably benign	0.00
R1973:Slc22a7	UTSW	17	46437090	missense	probably damaging	1.00
R2117:Slc22a7	UTSW	17	46433972	missense	possibly damaging	0.55
R4467:Slc22a7	UTSW	17	46432510	missense	probably benign
R4739:Slc22a7	UTSW	17	46434997	missense	probably damaging	1.00
R4921:Slc22a7	UTSW	17	46436933	missense	probably benign	0.00
R6982:Slc22a7	UTSW	17	46434637	missense	probably benign	0.02
R7412:Slc22a7	UTSW	17	46434627	missense	probably benign	0.00
R7634:Slc22a7	UTSW	17	46438230	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- ACACCTCTGTTCCCAAGGTG -3'
(R):5'- TGCACTCATCAGTACAACTATTCCC -3'

Sequencing Primer
(F):5'- CTCTGTTCCCAAGGTGACATTGG -3'
(R):5'- CACCTCCAGAGTCCAAGGG -3'

Posted On

2019-05-15