Incidental Mutation 'R0599:Rassf4'
ID 55212
Institutional Source Beutler Lab
Gene Symbol Rassf4
Ensembl Gene ENSMUSG00000042129
Gene Name Ras association (RalGDS/AF-6) domain family member 4
Synonyms 3830411C14Rik
MMRRC Submission 038788-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock # R0599 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 116633008-116673952 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 116645936 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 38 (E38G)
Ref Sequence ENSEMBL: ENSMUSP00000145076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035842] [ENSMUST00000067354] [ENSMUST00000178241] [ENSMUST00000203029] [ENSMUST00000204203] [ENSMUST00000204555] [ENSMUST00000204576]
AlphaFold Q8CB96
Predicted Effect probably benign
Transcript: ENSMUST00000035842
AA Change: E108G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000048267
Gene: ENSMUSG00000042129
AA Change: E108G

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
low complexity region 46 57 N/A INTRINSIC
RA 173 263 1.36e-15 SMART
Pfam:Nore1-SARAH 276 315 1.7e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067354
SMART Domains Protein: ENSMUSP00000070203
Gene: ENSMUSG00000048489

DomainStartEndE-ValueType
Pfam:DEPP 25 205 1.1e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178241
SMART Domains Protein: ENSMUSP00000136165
Gene: ENSMUSG00000048489

DomainStartEndE-ValueType
Pfam:DEPP 25 205 5.5e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184219
Predicted Effect probably benign
Transcript: ENSMUST00000203029
AA Change: E108G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144786
Gene: ENSMUSG00000042129
AA Change: E108G

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
low complexity region 46 57 N/A INTRINSIC
RA 173 263 8.7e-18 SMART
Pfam:Nore1-SARAH 276 303 1.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203634
Predicted Effect probably damaging
Transcript: ENSMUST00000204203
AA Change: E38G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204313
Predicted Effect probably benign
Transcript: ENSMUST00000204555
SMART Domains Protein: ENSMUSP00000145125
Gene: ENSMUSG00000048489

DomainStartEndE-ValueType
Pfam:DEPP 25 70 3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204576
SMART Domains Protein: ENSMUSP00000145394
Gene: ENSMUSG00000042129

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The function of this gene has not yet been determined but may involve a role in tumor suppression. Alternative splicing of this gene results in several transcript variants; however, most of the variants have not been fully described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,552,245 L978P probably damaging Het
Abcb1a C T 5: 8,698,539 T290M probably benign Het
Abcd3 A T 3: 121,765,093 F585I probably damaging Het
Acan A G 7: 79,111,290 probably benign Het
Anxa6 T C 11: 54,979,466 D667G possibly damaging Het
Ap3m2 G T 8: 22,793,112 A208D possibly damaging Het
Arhgap17 A T 7: 123,303,790 probably benign Het
Bptf A G 11: 107,068,382 V1838A probably damaging Het
Brip1 T A 11: 86,152,737 M334L probably benign Het
Btbd10 C T 7: 113,335,309 probably benign Het
Btbd11 G A 10: 85,658,336 G1106D probably damaging Het
Cdh7 C A 1: 110,052,966 T208K probably damaging Het
Cnga4 A G 7: 105,405,818 Y100C probably damaging Het
Dnah10 G A 5: 124,800,953 V2644M probably damaging Het
Dnah9 T C 11: 65,965,689 D2882G probably damaging Het
Eapp T A 12: 54,685,962 K117M probably damaging Het
Eml3 T C 19: 8,939,063 V673A probably benign Het
Ephb4 G A 5: 137,369,855 C754Y probably damaging Het
Eps8l1 A G 7: 4,477,957 D33G possibly damaging Het
Farsa A G 8: 84,867,583 K321E probably damaging Het
Fry G A 5: 150,437,159 R2090Q probably damaging Het
Gm10283 A G 8: 60,501,224 probably benign Het
Grm4 A G 17: 27,431,490 I844T probably benign Het
Gtf2h3 A G 5: 124,588,628 D124G probably benign Het
Gulo A T 14: 65,990,441 D347E probably damaging Het
Hmcn1 A G 1: 150,609,801 F4350S possibly damaging Het
Hspg2 A G 4: 137,512,401 D473G probably damaging Het
Il17ra T A 6: 120,481,505 I539N probably damaging Het
Insrr A G 3: 87,813,133 E1026G probably damaging Het
Itga2 A T 13: 114,856,650 probably benign Het
Kdm1b A T 13: 47,058,810 D190V possibly damaging Het
Lima1 A T 15: 99,802,159 N146K probably damaging Het
Mettl7a3 A T 15: 100,335,383 N152Y possibly damaging Het
Mnt G T 11: 74,842,296 V85L probably benign Het
Mon2 T A 10: 123,026,065 probably benign Het
Mtf1 T C 4: 124,820,201 probably benign Het
Mylk4 T C 13: 32,712,754 probably null Het
Myo18b A C 5: 112,865,750 L780R probably damaging Het
Myo1e A G 9: 70,376,660 probably benign Het
Obscn A G 11: 59,073,696 S705P probably damaging Het
Ocrl A T X: 47,936,086 probably benign Het
Olfr1260 T C 2: 89,978,201 F141S probably benign Het
Olfr394 A T 11: 73,887,904 M156K probably benign Het
Olfr599 A G 7: 103,338,186 N44S probably damaging Het
Olfr639 A T 7: 104,012,188 C171* probably null Het
Otof T A 5: 30,370,705 K1931N probably damaging Het
Plcxd3 A G 15: 4,516,867 S118G probably damaging Het
Plcz1 T A 6: 140,028,542 Q58L probably benign Het
Proser1 C A 3: 53,479,064 P789Q probably benign Het
Ros1 A T 10: 52,123,300 Y1164N probably damaging Het
Rpgrip1l A G 8: 91,305,000 I83T probably damaging Het
Scn9a T G 2: 66,526,799 K1053Q probably damaging Het
Sgsm1 G T 5: 113,245,028 Q1087K probably damaging Het
Slc16a10 T C 10: 40,141,918 D40G probably benign Het
Slc27a6 A G 18: 58,556,813 D117G probably damaging Het
Slc2a9 T A 5: 38,480,144 probably benign Het
Slc4a1 A G 11: 102,357,915 probably benign Het
Smarca1 T A X: 47,823,426 Q982L probably benign Het
Sp100 T A 1: 85,681,110 I320N possibly damaging Het
Stx8 A T 11: 68,109,362 R209S probably null Het
Sulf2 T C 2: 166,083,879 T453A possibly damaging Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tenm2 T A 11: 36,024,780 I1976F possibly damaging Het
Tenm3 G A 8: 48,277,710 S1341L probably damaging Het
Tmem130 C T 5: 144,737,809 V369M probably damaging Het
Tmem200c A G 17: 68,840,511 K30E probably damaging Het
Tmem225 A G 9: 40,149,747 I117V possibly damaging Het
Top2a A G 11: 99,001,417 I1073T probably damaging Het
Trps1 A C 15: 50,831,860 Y296* probably null Het
Tubg1 T C 11: 101,125,336 M377T probably benign Het
Vmn1r35 G A 6: 66,679,513 H58Y probably benign Het
Vmn1r56 G A 7: 5,196,430 H63Y probably benign Het
Vmn1r75 T C 7: 11,881,262 probably null Het
Vnn3 T C 10: 23,865,705 S303P possibly damaging Het
Wdr49 C T 3: 75,431,076 probably null Het
Wdr49 T C 3: 75,449,890 probably null Het
Zcchc6 A G 13: 59,809,487 V7A probably damaging Het
Zzef1 T C 11: 72,913,178 L2582P probably damaging Het
Other mutations in Rassf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Rassf4 APN 6 116645128 missense possibly damaging 0.47
IGL01132:Rassf4 APN 6 116659607 splice site probably benign
IGL01637:Rassf4 APN 6 116641690 missense probably damaging 1.00
IGL02000:Rassf4 APN 6 116645972 missense probably benign 0.20
IGL02748:Rassf4 APN 6 116639457 missense possibly damaging 0.93
IGL02976:Rassf4 APN 6 116638248 missense probably damaging 0.96
IGL03394:Rassf4 APN 6 116641747 missense probably damaging 1.00
R0573:Rassf4 UTSW 6 116647555 splice site probably benign
R1741:Rassf4 UTSW 6 116639489 missense probably damaging 1.00
R1750:Rassf4 UTSW 6 116640267 missense probably damaging 1.00
R2117:Rassf4 UTSW 6 116645127 missense possibly damaging 0.86
R2369:Rassf4 UTSW 6 116638297 missense probably damaging 0.97
R2916:Rassf4 UTSW 6 116641740 missense probably damaging 1.00
R2918:Rassf4 UTSW 6 116641740 missense probably damaging 1.00
R4829:Rassf4 UTSW 6 116645142 missense possibly damaging 0.80
R5716:Rassf4 UTSW 6 116661867 missense probably benign 0.01
R6769:Rassf4 UTSW 6 116641472 missense possibly damaging 0.95
R7304:Rassf4 UTSW 6 116640317 missense probably damaging 0.99
R7981:Rassf4 UTSW 6 116640257 missense probably damaging 1.00
R8890:Rassf4 UTSW 6 116640344 missense probably damaging 1.00
R8921:Rassf4 UTSW 6 116661936 splice site probably benign
R9459:Rassf4 UTSW 6 116641788 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACTTCAGAAGACTCAGGCCAAGGAC -3'
(R):5'- AGGGATAGCTTCCACTCCTTCCAAC -3'

Sequencing Primer
(F):5'- GGCAACACTTCTATAAGCCTCTG -3'
(R):5'- TCCAACAGATGCTGTGGGG -3'
Posted On 2013-07-11