Incidental Mutation 'R7123:Cfap157'
ID552124
Institutional Source Beutler Lab
Gene Symbol Cfap157
Ensembl Gene ENSMUSG00000038987
Gene Namecilia and flagella associated protein 157
Synonyms1700019L03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R7123 (G1)
Quality Score180.009
Status Validated
Chromosome2
Chromosomal Location32777381-32784428 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32779401 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 294 (E294G)
Ref Sequence ENSEMBL: ENSMUSP00000099877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066352] [ENSMUST00000066478] [ENSMUST00000091059] [ENSMUST00000102813] [ENSMUST00000125891] [ENSMUST00000161089] [ENSMUST00000161430] [ENSMUST00000161950] [ENSMUST00000161958]
Predicted Effect probably benign
Transcript: ENSMUST00000066352
SMART Domains Protein: ENSMUSP00000068850
Gene: ENSMUSG00000053746

DomainStartEndE-ValueType
Pfam:Pept_tRNA_hydro 22 200 6.3e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066478
SMART Domains Protein: ENSMUSP00000068977
Gene: ENSMUSG00000039021

DomainStartEndE-ValueType
TPR 18 51 2.26e-3 SMART
TPR 52 85 4.09e-1 SMART
TPR 93 126 8.3e-2 SMART
TPR 161 194 4.44e1 SMART
TPR 208 241 3.69e1 SMART
TPR 242 275 1.08e1 SMART
Blast:TPR 288 321 2e-10 BLAST
TPR 322 355 1.02e-1 SMART
TPR 363 396 7.27e0 SMART
Blast:TPR 397 430 2e-12 BLAST
low complexity region 539 554 N/A INTRINSIC
low complexity region 565 577 N/A INTRINSIC
low complexity region 629 640 N/A INTRINSIC
low complexity region 725 750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091059
SMART Domains Protein: ENSMUSP00000088585
Gene: ENSMUSG00000039021

DomainStartEndE-ValueType
TPR 75 108 2.26e-3 SMART
TPR 109 142 4.09e-1 SMART
TPR 150 183 8.3e-2 SMART
TPR 218 251 4.44e1 SMART
TPR 265 298 3.69e1 SMART
TPR 299 332 1.08e1 SMART
Blast:TPR 345 378 2e-10 BLAST
TPR 379 412 1.02e-1 SMART
TPR 420 453 7.27e0 SMART
Blast:TPR 454 487 2e-12 BLAST
low complexity region 631 644 N/A INTRINSIC
low complexity region 666 679 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102813
AA Change: E294G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099877
Gene: ENSMUSG00000038987
AA Change: E294G

DomainStartEndE-ValueType
coiled coil region 32 191 N/A INTRINSIC
coiled coil region 301 371 N/A INTRINSIC
low complexity region 402 416 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125891
Predicted Effect probably benign
Transcript: ENSMUST00000161089
SMART Domains Protein: ENSMUSP00000124915
Gene: ENSMUSG00000039021

DomainStartEndE-ValueType
TPR 18 51 2.26e-3 SMART
TPR 52 85 4.09e-1 SMART
TPR 93 126 8.3e-2 SMART
TPR 161 194 4.44e1 SMART
TPR 208 241 3.69e1 SMART
TPR 242 275 1.08e1 SMART
Blast:TPR 288 321 2e-10 BLAST
TPR 322 355 1.02e-1 SMART
TPR 363 396 7.27e0 SMART
Blast:TPR 397 430 2e-12 BLAST
low complexity region 539 554 N/A INTRINSIC
low complexity region 565 577 N/A INTRINSIC
low complexity region 629 640 N/A INTRINSIC
low complexity region 725 750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161430
SMART Domains Protein: ENSMUSP00000124031
Gene: ENSMUSG00000039021

DomainStartEndE-ValueType
TPR 75 108 2.26e-3 SMART
TPR 109 142 4.09e-1 SMART
TPR 150 183 8.3e-2 SMART
TPR 218 251 4.44e1 SMART
TPR 265 298 3.69e1 SMART
TPR 299 332 1.08e1 SMART
Blast:TPR 345 378 2e-10 BLAST
TPR 379 412 1.02e-1 SMART
TPR 420 453 7.27e0 SMART
Blast:TPR 454 487 2e-12 BLAST
low complexity region 596 611 N/A INTRINSIC
low complexity region 622 634 N/A INTRINSIC
low complexity region 686 697 N/A INTRINSIC
low complexity region 782 807 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161950
SMART Domains Protein: ENSMUSP00000123927
Gene: ENSMUSG00000039021

DomainStartEndE-ValueType
TPR 18 51 2.26e-3 SMART
TPR 52 85 4.09e-1 SMART
TPR 93 126 8.3e-2 SMART
TPR 161 194 4.44e1 SMART
TPR 208 241 3.69e1 SMART
TPR 242 275 1.08e1 SMART
Blast:TPR 288 321 2e-10 BLAST
TPR 322 355 1.02e-1 SMART
TPR 363 396 7.27e0 SMART
Blast:TPR 397 430 2e-12 BLAST
low complexity region 539 554 N/A INTRINSIC
low complexity region 565 577 N/A INTRINSIC
low complexity region 629 640 N/A INTRINSIC
low complexity region 725 750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161958
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (52/53)
MGI Phenotype PHENOTYPE: Homozygous knockout males are infertile owing to reduced sperm count and reduced and abnormal sperm motility as a result of abnormal sperm morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik G A 13: 59,743,440 Q189* probably null Het
Abca17 A G 17: 24,265,975 I1521T probably damaging Het
Adgrv1 A T 13: 81,592,574 I145N probably damaging Het
Ago3 C A 4: 126,355,005 probably null Het
Agrn A T 4: 156,172,840 W1178R probably benign Het
Akap3 A T 6: 126,866,304 I629L probably benign Het
Aknad1 T G 3: 108,775,244 Y545* probably null Het
Anapc1 C A 2: 128,613,010 V1925F probably damaging Het
Barhl1 C T 2: 28,909,931 probably null Het
Cfd G A 10: 79,892,497 G231S probably damaging Het
Csf2ra A G 19: 61,226,862 V105A probably damaging Het
Dhtkd1 A T 2: 5,917,780 W523R probably damaging Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dnajc22 A C 15: 99,101,204 Y90S possibly damaging Het
Ebna1bp2 A G 4: 118,625,575 K254E probably damaging Het
Gfpt1 A T 6: 87,056,186 D131V probably damaging Het
Gm5460 A G 14: 34,042,025 I21V unknown Het
Gm7030 A G 17: 36,127,794 I235T possibly damaging Het
Htr1d C T 4: 136,442,353 probably benign Het
Kndc1 G A 7: 139,936,836 E1570K probably damaging Het
Kntc1 T C 5: 123,781,726 Y887H probably damaging Het
Kti12 T C 4: 108,848,482 S198P probably benign Het
Mcmdc2 A T 1: 9,940,418 I604F unknown Het
Mmp8 A T 9: 7,563,195 D253V probably damaging Het
Muc4 T C 16: 32,750,691 S252P possibly damaging Het
Myo5c A G 9: 75,289,223 K1317R probably benign Het
Ncoa7 T C 10: 30,654,439 I749V probably benign Het
Nfrkb A G 9: 31,414,015 probably null Het
Obscn T C 11: 59,013,651 T7166A probably benign Het
Obsl1 A G 1: 75,489,669 S1472P probably damaging Het
Olfr128 T A 17: 37,923,676 L37M probably benign Het
Olfr379-ps1 T A 11: 73,433,710 D172V unknown Het
Orc1 A C 4: 108,588,687 M1L probably damaging Het
Pkd1 T A 17: 24,594,768 S4069T possibly damaging Het
Pus1 T C 5: 110,773,932 *442W probably null Het
Rgma A C 7: 73,409,391 D97A probably damaging Het
Ryr1 T C 7: 29,046,854 K3834E probably benign Het
Sars2 T C 7: 28,753,441 V475A probably benign Het
Scamp2 A T 9: 57,587,102 T253S probably benign Het
Skint9 C T 4: 112,390,977 W190* probably null Het
Sv2b C T 7: 75,117,702 V649I possibly damaging Het
Synpo2 A G 3: 123,113,186 V827A probably benign Het
Tiparp A T 3: 65,553,527 I646F probably damaging Het
Topaz1 G A 9: 122,748,415 G130D probably damaging Het
Trio TACCTTGTTACTGAGCCCTTCTCACCTTCACAGACACCTTGTTACTGAGCCCTTCTCACCTTCACAGATACCTTGTTACTGAGCCCTTCTC TACCTTGTTACTGAGCCCTTCTCACCTTCACAGATACCTTGTTACTGAGCCCTTCTC 15: 27,742,313 probably benign Het
Ttll7 C T 3: 146,913,296 P319S possibly damaging Het
Umodl1 T A 17: 30,982,344 F416I possibly damaging Het
Vmn2r104 T C 17: 20,040,826 D445G probably benign Het
Wnk2 A G 13: 49,081,986 V651A possibly damaging Het
Zbtb21 C T 16: 97,949,912 S1057N probably damaging Het
Zfp451 A T 1: 33,776,869 C667S probably damaging Het
Other mutations in Cfap157
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Cfap157 APN 2 32781383 missense probably damaging 1.00
IGL00852:Cfap157 APN 2 32779815 missense possibly damaging 0.89
IGL01284:Cfap157 APN 2 32781479 missense possibly damaging 0.69
IGL02315:Cfap157 APN 2 32778165 missense probably benign 0.02
PIT4810001:Cfap157 UTSW 2 32781432 missense probably damaging 0.96
R0654:Cfap157 UTSW 2 32779942 missense probably damaging 1.00
R0699:Cfap157 UTSW 2 32779010 missense probably damaging 1.00
R1103:Cfap157 UTSW 2 32781398 missense probably damaging 1.00
R1123:Cfap157 UTSW 2 32777923 missense possibly damaging 0.93
R2165:Cfap157 UTSW 2 32778163 unclassified probably null
R4304:Cfap157 UTSW 2 32779042 missense probably damaging 1.00
R4307:Cfap157 UTSW 2 32779042 missense probably damaging 1.00
R4308:Cfap157 UTSW 2 32779042 missense probably damaging 1.00
R4439:Cfap157 UTSW 2 32777865 missense probably benign 0.00
R4859:Cfap157 UTSW 2 32777542 missense probably benign 0.00
R4880:Cfap157 UTSW 2 32778249 missense probably damaging 1.00
R4917:Cfap157 UTSW 2 32779953 missense probably benign 0.19
R5808:Cfap157 UTSW 2 32780645 missense probably damaging 1.00
R6052:Cfap157 UTSW 2 32779851 missense probably damaging 1.00
R6405:Cfap157 UTSW 2 32781396 missense probably damaging 1.00
R6502:Cfap157 UTSW 2 32780678 missense probably damaging 1.00
R6647:Cfap157 UTSW 2 32779074 missense probably benign
R6959:Cfap157 UTSW 2 32784248 missense probably damaging 1.00
R7469:Cfap157 UTSW 2 32780684 missense probably damaging 1.00
R7527:Cfap157 UTSW 2 32779878 missense possibly damaging 0.86
R7573:Cfap157 UTSW 2 32777508 missense probably benign 0.00
R7697:Cfap157 UTSW 2 32779753 missense probably benign 0.01
R7911:Cfap157 UTSW 2 32778207 missense probably damaging 1.00
R8338:Cfap157 UTSW 2 32778006 missense possibly damaging 0.54
X0020:Cfap157 UTSW 2 32779855 missense probably benign 0.35
Z1177:Cfap157 UTSW 2 32778207 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCTTTCTAAATCCAGGCTTC -3'
(R):5'- GCTCTGGAGTCTATTTGCCC -3'

Sequencing Primer
(F):5'- AGGCTTCAACTTGTCTGACAG -3'
(R):5'- TTTGCCCCATAACTAAGTGGAGC -3'
Posted On2019-05-15