Mutagenetix > Incidental Mutation

Incidental Mutation 'R0599:A2ml1'

55214

Institutional Source

Beutler Lab

Gene Symbol

A2ml1

Ensembl Gene

ENSMUSG00000047228

Gene Name

alpha-2-macroglobulin like 1

Synonyms

MMRRC Submission

038788-MU

Accession Numbers

Genbank: NM_001001179.3; Ensembl: ENSMUST00000060574

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0599 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

128539821-128581608 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 128552245 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 978 (L978P)

Ref Sequence

ENSEMBL: ENSMUSP00000059426 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060574]

AlphaFold

Q3UU35

Predicted Effect

probably damaging
Transcript: ENSMUST00000060574
AA Change: L978P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000059426
Gene: ENSMUSG00000047228
AA Change: L978P

Domain	Start	End	E-Value	Type
low complexity region	42	58	N/A	INTRINSIC
Pfam:A2M_N	120	213	6.3e-17	PFAM
A2M_N_2	448	594	2.95e-37	SMART
A2M	736	826	2.11e-33	SMART
Pfam:Thiol-ester_cl	959	988	3.1e-17	PFAM
Pfam:A2M_comp	1008	1255	2.3e-71	PFAM
A2M_recep	1361	1447	1.22e-29	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205167

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.5%
20x: 95.0%

Validation Efficiency

98% (80/82)

Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1a	C	T	5: 8,698,539	T290M	probably benign	Het
Abcd3	A	T	3: 121,765,093	F585I	probably damaging	Het
Acan	A	G	7: 79,111,290		probably benign	Het
Anxa6	T	C	11: 54,979,466	D667G	possibly damaging	Het
Ap3m2	G	T	8: 22,793,112	A208D	possibly damaging	Het
Arhgap17	A	T	7: 123,303,790		probably benign	Het
Bptf	A	G	11: 107,068,382	V1838A	probably damaging	Het
Brip1	T	A	11: 86,152,737	M334L	probably benign	Het
Btbd10	C	T	7: 113,335,309		probably benign	Het
Btbd11	G	A	10: 85,658,336	G1106D	probably damaging	Het
Cdh7	C	A	1: 110,052,966	T208K	probably damaging	Het
Cnga4	A	G	7: 105,405,818	Y100C	probably damaging	Het
Dnah10	G	A	5: 124,800,953	V2644M	probably damaging	Het
Dnah9	T	C	11: 65,965,689	D2882G	probably damaging	Het
Eapp	T	A	12: 54,685,962	K117M	probably damaging	Het
Eml3	T	C	19: 8,939,063	V673A	probably benign	Het
Ephb4	G	A	5: 137,369,855	C754Y	probably damaging	Het
Eps8l1	A	G	7: 4,477,957	D33G	possibly damaging	Het
Farsa	A	G	8: 84,867,583	K321E	probably damaging	Het
Fry	G	A	5: 150,437,159	R2090Q	probably damaging	Het
Gm10283	A	G	8: 60,501,224		probably benign	Het
Grm4	A	G	17: 27,431,490	I844T	probably benign	Het
Gtf2h3	A	G	5: 124,588,628	D124G	probably benign	Het
Gulo	A	T	14: 65,990,441	D347E	probably damaging	Het
Hmcn1	A	G	1: 150,609,801	F4350S	possibly damaging	Het
Hspg2	A	G	4: 137,512,401	D473G	probably damaging	Het
Il17ra	T	A	6: 120,481,505	I539N	probably damaging	Het
Insrr	A	G	3: 87,813,133	E1026G	probably damaging	Het
Itga2	A	T	13: 114,856,650		probably benign	Het
Kdm1b	A	T	13: 47,058,810	D190V	possibly damaging	Het
Lima1	A	T	15: 99,802,159	N146K	probably damaging	Het
Mettl7a3	A	T	15: 100,335,383	N152Y	possibly damaging	Het
Mnt	G	T	11: 74,842,296	V85L	probably benign	Het
Mon2	T	A	10: 123,026,065		probably benign	Het
Mtf1	T	C	4: 124,820,201		probably benign	Het
Mylk4	T	C	13: 32,712,754		probably null	Het
Myo18b	A	C	5: 112,865,750	L780R	probably damaging	Het
Myo1e	A	G	9: 70,376,660		probably benign	Het
Obscn	A	G	11: 59,073,696	S705P	probably damaging	Het
Ocrl	A	T	X: 47,936,086		probably benign	Het
Olfr1260	T	C	2: 89,978,201	F141S	probably benign	Het
Olfr394	A	T	11: 73,887,904	M156K	probably benign	Het
Olfr599	A	G	7: 103,338,186	N44S	probably damaging	Het
Olfr639	A	T	7: 104,012,188	C171*	probably null	Het
Otof	T	A	5: 30,370,705	K1931N	probably damaging	Het
Plcxd3	A	G	15: 4,516,867	S118G	probably damaging	Het
Plcz1	T	A	6: 140,028,542	Q58L	probably benign	Het
Proser1	C	A	3: 53,479,064	P789Q	probably benign	Het
Rassf4	T	C	6: 116,645,936	E38G	probably damaging	Het
Ros1	A	T	10: 52,123,300	Y1164N	probably damaging	Het
Rpgrip1l	A	G	8: 91,305,000	I83T	probably damaging	Het
Scn9a	T	G	2: 66,526,799	K1053Q	probably damaging	Het
Sgsm1	G	T	5: 113,245,028	Q1087K	probably damaging	Het
Slc16a10	T	C	10: 40,141,918	D40G	probably benign	Het
Slc27a6	A	G	18: 58,556,813	D117G	probably damaging	Het
Slc2a9	T	A	5: 38,480,144		probably benign	Het
Slc4a1	A	G	11: 102,357,915		probably benign	Het
Smarca1	T	A	X: 47,823,426	Q982L	probably benign	Het
Sp100	T	A	1: 85,681,110	I320N	possibly damaging	Het
Stx8	A	T	11: 68,109,362	R209S	probably null	Het
Sulf2	T	C	2: 166,083,879	T453A	possibly damaging	Het
Syne2	AGAGTGAG	AGAGTGAGTGAG	12: 76,097,960		probably null	Het
Tenm2	T	A	11: 36,024,780	I1976F	possibly damaging	Het
Tenm3	G	A	8: 48,277,710	S1341L	probably damaging	Het
Tmem130	C	T	5: 144,737,809	V369M	probably damaging	Het
Tmem200c	A	G	17: 68,840,511	K30E	probably damaging	Het
Tmem225	A	G	9: 40,149,747	I117V	possibly damaging	Het
Top2a	A	G	11: 99,001,417	I1073T	probably damaging	Het
Trps1	A	C	15: 50,831,860	Y296*	probably null	Het
Tubg1	T	C	11: 101,125,336	M377T	probably benign	Het
Vmn1r35	G	A	6: 66,679,513	H58Y	probably benign	Het
Vmn1r56	G	A	7: 5,196,430	H63Y	probably benign	Het
Vmn1r75	T	C	7: 11,881,262		probably null	Het
Vnn3	T	C	10: 23,865,705	S303P	possibly damaging	Het
Wdr49	C	T	3: 75,431,076		probably null	Het
Wdr49	T	C	3: 75,449,890		probably null	Het
Zcchc6	A	G	13: 59,809,487	V7A	probably damaging	Het
Zzef1	T	C	11: 72,913,178	L2582P	probably damaging	Het

Other mutations in A2ml1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00513:A2ml1	APN	6	128578156	missense	possibly damaging	0.78
IGL00596:A2ml1	APN	6	128570067	missense	probably damaging	0.99
IGL00912:A2ml1	APN	6	128552307	missense	probably benign	0.04
IGL01320:A2ml1	APN	6	128575588	missense	probably benign	0.00
IGL01470:A2ml1	APN	6	128580412	missense	probably damaging	0.96
IGL01576:A2ml1	APN	6	128554330	splice site	probably benign
IGL01761:A2ml1	APN	6	128546337	missense	possibly damaging	0.61
IGL01792:A2ml1	APN	6	128560679	missense	probably benign	0.04
IGL01843:A2ml1	APN	6	128553338	splice site	probably benign
IGL01946:A2ml1	APN	6	128570479	missense	possibly damaging	0.81
IGL02016:A2ml1	APN	6	128558335	missense	probably damaging	1.00
IGL02170:A2ml1	APN	6	128547210	missense	possibly damaging	0.58
IGL02269:A2ml1	APN	6	128553338	splice site	probably benign
IGL02589:A2ml1	APN	6	128581500	missense	probably benign	0.00
IGL02959:A2ml1	APN	6	128567060	missense	probably benign	0.04
IGL02970:A2ml1	APN	6	128569979	missense	probably damaging	1.00
IGL03206:A2ml1	APN	6	128553276	missense	possibly damaging	0.50
IGL03298:A2ml1	APN	6	128543960	missense	probably benign	0.00
1mM(1):A2ml1	UTSW	6	128580960	missense	probably benign	0.02
R0055:A2ml1	UTSW	6	128570094	splice site	probably benign
R0055:A2ml1	UTSW	6	128570094	splice site	probably benign
R0069:A2ml1	UTSW	6	128561562	missense	probably damaging	1.00
R0069:A2ml1	UTSW	6	128561562	missense	probably damaging	1.00
R0128:A2ml1	UTSW	6	128575639	splice site	probably benign
R0299:A2ml1	UTSW	6	128553232	splice site	probably benign
R0523:A2ml1	UTSW	6	128558326	missense	possibly damaging	0.92
R0565:A2ml1	UTSW	6	128568743	nonsense	probably null
R0626:A2ml1	UTSW	6	128550773	missense	probably damaging	0.99
R0732:A2ml1	UTSW	6	128546448	missense	probably damaging	1.00
R0880:A2ml1	UTSW	6	128560646	missense	possibly damaging	0.49
R1070:A2ml1	UTSW	6	128543300	missense	probably damaging	1.00
R1166:A2ml1	UTSW	6	128570917	missense	probably benign	0.00
R1278:A2ml1	UTSW	6	128558507	missense	probably damaging	1.00
R1421:A2ml1	UTSW	6	128543960	missense	probably benign	0.00
R1536:A2ml1	UTSW	6	128547233	nonsense	probably null
R1786:A2ml1	UTSW	6	128576260	missense	probably damaging	1.00
R1808:A2ml1	UTSW	6	128543299	missense	probably damaging	1.00
R1813:A2ml1	UTSW	6	128566273	missense	probably benign	0.34
R1863:A2ml1	UTSW	6	128550783	missense	probably damaging	0.99
R2007:A2ml1	UTSW	6	128542892	missense	probably benign	0.13
R2062:A2ml1	UTSW	6	128552308	missense	probably benign	0.08
R2127:A2ml1	UTSW	6	128558437	missense	probably damaging	1.00
R2130:A2ml1	UTSW	6	128576260	missense	probably damaging	1.00
R2131:A2ml1	UTSW	6	128576260	missense	probably damaging	1.00
R2201:A2ml1	UTSW	6	128547305	missense	probably null	0.34
R2319:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2321:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2322:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2369:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2370:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2371:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2372:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2375:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2893:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2894:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R3438:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R3615:A2ml1	UTSW	6	128558294	missense	probably benign	0.07
R3616:A2ml1	UTSW	6	128558294	missense	probably benign	0.07
R3773:A2ml1	UTSW	6	128555083	missense	probably benign	0.02
R3785:A2ml1	UTSW	6	128544924	critical splice donor site	probably null
R3803:A2ml1	UTSW	6	128545070	missense	probably benign	0.17
R3824:A2ml1	UTSW	6	128568763	missense	probably damaging	0.99
R3878:A2ml1	UTSW	6	128554361	missense	probably benign	0.05
R4176:A2ml1	UTSW	6	128545037	missense	possibly damaging	0.68
R4229:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R4230:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R4348:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R4351:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R4352:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R4353:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R4427:A2ml1	UTSW	6	128545046	missense	probably benign	0.00
R4971:A2ml1	UTSW	6	128547227	missense	probably damaging	0.98
R5014:A2ml1	UTSW	6	128543933	missense	probably benign	0.00
R5369:A2ml1	UTSW	6	128568833	missense	probably damaging	0.97
R5532:A2ml1	UTSW	6	128553330	critical splice acceptor site	probably null
R5860:A2ml1	UTSW	6	128541061	missense	probably benign	0.15
R5872:A2ml1	UTSW	6	128561526	missense	probably damaging	1.00
R5926:A2ml1	UTSW	6	128560645	missense	probably benign
R5977:A2ml1	UTSW	6	128581122	missense	probably damaging	1.00
R5980:A2ml1	UTSW	6	128567055	missense	possibly damaging	0.82
R6014:A2ml1	UTSW	6	128571985	missense	probably damaging	1.00
R6032:A2ml1	UTSW	6	128549836	nonsense	probably null
R6032:A2ml1	UTSW	6	128549836	nonsense	probably null
R6061:A2ml1	UTSW	6	128568712	missense	probably damaging	1.00
R6327:A2ml1	UTSW	6	128558692	splice site	probably null
R6331:A2ml1	UTSW	6	128552236	missense	probably damaging	0.96
R6465:A2ml1	UTSW	6	128541078	missense	probably damaging	1.00
R6640:A2ml1	UTSW	6	128553285	missense	probably benign	0.41
R6792:A2ml1	UTSW	6	128546329	nonsense	probably null
R6793:A2ml1	UTSW	6	128546329	nonsense	probably null
R7207:A2ml1	UTSW	6	128550771	missense	probably benign	0.04
R7378:A2ml1	UTSW	6	128546247	critical splice donor site	probably null
R7556:A2ml1	UTSW	6	128569964	missense	probably damaging	1.00
R8010:A2ml1	UTSW	6	128580340	missense	probably benign	0.08
R8017:A2ml1	UTSW	6	128581447	critical splice donor site	probably null
R8019:A2ml1	UTSW	6	128581447	critical splice donor site	probably null
R8035:A2ml1	UTSW	6	128553280	missense	probably damaging	0.99
R8094:A2ml1	UTSW	6	128572082	missense	probably damaging	1.00
R8144:A2ml1	UTSW	6	128569999	missense	possibly damaging	0.84
R8365:A2ml1	UTSW	6	128580955	nonsense	probably null
R8382:A2ml1	UTSW	6	128560682	missense	probably benign	0.01
R8388:A2ml1	UTSW	6	128571974	missense	probably benign	0.03
R8717:A2ml1	UTSW	6	128566995	missense	probably benign	0.00
R8947:A2ml1	UTSW	6	128552256	missense	probably damaging	1.00
R8970:A2ml1	UTSW	6	128568763	missense	probably damaging	0.99
R9025:A2ml1	UTSW	6	128557582	missense	possibly damaging	0.49
R9083:A2ml1	UTSW	6	128557561	missense	possibly damaging	0.90
R9129:A2ml1	UTSW	6	128546260	missense	probably damaging	1.00
R9145:A2ml1	UTSW	6	128559069	missense	probably benign
R9165:A2ml1	UTSW	6	128560669	missense	probably benign
R9285:A2ml1	UTSW	6	128549793	missense	probably benign
R9408:A2ml1	UTSW	6	128545067	missense	probably damaging	0.98
R9486:A2ml1	UTSW	6	128569979	missense	probably damaging	0.99
R9781:A2ml1	UTSW	6	128542897	missense	probably benign	0.01
RF014:A2ml1	UTSW	6	128570068	missense	probably damaging	0.96
X0063:A2ml1	UTSW	6	128572012	missense	probably benign
Z1176:A2ml1	UTSW	6	128571977	missense	probably benign	0.09
Z1177:A2ml1	UTSW	6	128545076	missense	probably benign
Z1177:A2ml1	UTSW	6	128561616	nonsense	probably null
Z1177:A2ml1	UTSW	6	128575607	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- AAACTACAGTTCTCTGTCAGGAGGCT -3'
(R):5'- CCACCATGCCCTGCGGTTATTA -3'

Sequencing Primer
(F):5'- GAGGACCTAAATGTCCACTCTTG -3'
(R):5'- TAGTGCTGAGGCAGTGACC -3'

Posted On

2013-07-11