Incidental Mutation 'R7123:Nfrkb'
ID552147
Institutional Source Beutler Lab
Gene Symbol Nfrkb
Ensembl Gene ENSMUSG00000042185
Gene Namenuclear factor related to kappa B binding protein
SynonymsA530090G11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.741) question?
Stock #R7123 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location31386192-31421333 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 31414015 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000083341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086167] [ENSMUST00000132329] [ENSMUST00000152593]
Predicted Effect probably null
Transcript: ENSMUST00000086167
SMART Domains Protein: ENSMUSP00000083341
Gene: ENSMUSG00000042185

DomainStartEndE-ValueType
low complexity region 209 234 N/A INTRINSIC
coiled coil region 304 335 N/A INTRINSIC
Pfam:NFRKB_winged 379 478 4.5e-35 PFAM
low complexity region 663 690 N/A INTRINSIC
low complexity region 700 740 N/A INTRINSIC
internal_repeat_1 879 953 2.02e-5 PROSPERO
low complexity region 1016 1034 N/A INTRINSIC
low complexity region 1111 1127 N/A INTRINSIC
internal_repeat_1 1128 1201 2.02e-5 PROSPERO
low complexity region 1239 1255 N/A INTRINSIC
low complexity region 1269 1290 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132329
Predicted Effect probably benign
Transcript: ENSMUST00000152593
SMART Domains Protein: ENSMUSP00000119025
Gene: ENSMUSG00000042185

DomainStartEndE-ValueType
low complexity region 209 234 N/A INTRINSIC
Meta Mutation Damage Score 0.9498 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik G A 13: 59,743,440 Q189* probably null Het
Abca17 A G 17: 24,265,975 I1521T probably damaging Het
Adgrv1 A T 13: 81,592,574 I145N probably damaging Het
Ago3 C A 4: 126,355,005 probably null Het
Agrn A T 4: 156,172,840 W1178R probably benign Het
Akap3 A T 6: 126,866,304 I629L probably benign Het
Aknad1 T G 3: 108,775,244 Y545* probably null Het
Anapc1 C A 2: 128,613,010 V1925F probably damaging Het
Barhl1 C T 2: 28,909,931 probably null Het
Cfap157 T C 2: 32,779,401 E294G probably damaging Het
Cfd G A 10: 79,892,497 G231S probably damaging Het
Csf2ra A G 19: 61,226,862 V105A probably damaging Het
Dhtkd1 A T 2: 5,917,780 W523R probably damaging Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dnajc22 A C 15: 99,101,204 Y90S possibly damaging Het
Ebna1bp2 A G 4: 118,625,575 K254E probably damaging Het
Gfpt1 A T 6: 87,056,186 D131V probably damaging Het
Gm5460 A G 14: 34,042,025 I21V unknown Het
Gm7030 A G 17: 36,127,794 I235T possibly damaging Het
Htr1d C T 4: 136,442,353 probably benign Het
Kndc1 G A 7: 139,936,836 E1570K probably damaging Het
Kntc1 T C 5: 123,781,726 Y887H probably damaging Het
Kti12 T C 4: 108,848,482 S198P probably benign Het
Mcmdc2 A T 1: 9,940,418 I604F unknown Het
Mmp8 A T 9: 7,563,195 D253V probably damaging Het
Muc4 T C 16: 32,750,691 S252P possibly damaging Het
Myo5c A G 9: 75,289,223 K1317R probably benign Het
Ncoa7 T C 10: 30,654,439 I749V probably benign Het
Obscn T C 11: 59,013,651 T7166A probably benign Het
Obsl1 A G 1: 75,489,669 S1472P probably damaging Het
Olfr128 T A 17: 37,923,676 L37M probably benign Het
Olfr379-ps1 T A 11: 73,433,710 D172V unknown Het
Orc1 A C 4: 108,588,687 M1L probably damaging Het
Pkd1 T A 17: 24,594,768 S4069T possibly damaging Het
Pus1 T C 5: 110,773,932 *442W probably null Het
Rgma A C 7: 73,409,391 D97A probably damaging Het
Ryr1 T C 7: 29,046,854 K3834E probably benign Het
Sars2 T C 7: 28,753,441 V475A probably benign Het
Scamp2 A T 9: 57,587,102 T253S probably benign Het
Skint9 C T 4: 112,390,977 W190* probably null Het
Sv2b C T 7: 75,117,702 V649I possibly damaging Het
Synpo2 A G 3: 123,113,186 V827A probably benign Het
Tiparp A T 3: 65,553,527 I646F probably damaging Het
Topaz1 G A 9: 122,748,415 G130D probably damaging Het
Trio TACCTTGTTACTGAGCCCTTCTCACCTTCACAGACACCTTGTTACTGAGCCCTTCTCACCTTCACAGATACCTTGTTACTGAGCCCTTCTC TACCTTGTTACTGAGCCCTTCTCACCTTCACAGATACCTTGTTACTGAGCCCTTCTC 15: 27,742,313 probably benign Het
Ttll7 C T 3: 146,913,296 P319S possibly damaging Het
Umodl1 T A 17: 30,982,344 F416I possibly damaging Het
Vmn2r104 T C 17: 20,040,826 D445G probably benign Het
Wnk2 A G 13: 49,081,986 V651A possibly damaging Het
Zbtb21 C T 16: 97,949,912 S1057N probably damaging Het
Zfp451 A T 1: 33,776,869 C667S probably damaging Het
Other mutations in Nfrkb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00688:Nfrkb APN 9 31389049 missense probably damaging 0.99
IGL01343:Nfrkb APN 9 31388954 missense probably damaging 0.99
IGL01363:Nfrkb APN 9 31414371 missense possibly damaging 0.53
IGL01647:Nfrkb APN 9 31396505 splice site probably benign
IGL01655:Nfrkb APN 9 31403459 missense probably benign 0.09
IGL01735:Nfrkb APN 9 31410139 missense possibly damaging 0.73
IGL01926:Nfrkb APN 9 31414179 missense probably benign 0.01
IGL01929:Nfrkb APN 9 31419873 missense possibly damaging 0.73
IGL02095:Nfrkb APN 9 31411231 missense probably damaging 0.97
IGL02370:Nfrkb APN 9 31389012 missense probably benign 0.08
IGL02525:Nfrkb APN 9 31414516 missense possibly damaging 0.73
R0325:Nfrkb UTSW 9 31414180 missense probably benign 0.06
R0390:Nfrkb UTSW 9 31388897 start gained probably benign
R0558:Nfrkb UTSW 9 31410268 missense possibly damaging 0.73
R0670:Nfrkb UTSW 9 31420173 missense probably benign 0.33
R1329:Nfrkb UTSW 9 31414647 missense possibly damaging 0.93
R1729:Nfrkb UTSW 9 31414636 missense probably benign 0.00
R1730:Nfrkb UTSW 9 31414636 missense probably benign 0.00
R1894:Nfrkb UTSW 9 31414768 missense probably benign 0.02
R1975:Nfrkb UTSW 9 31414684 missense possibly damaging 0.86
R2022:Nfrkb UTSW 9 31411250 missense probably benign 0.04
R2175:Nfrkb UTSW 9 31389014 missense possibly damaging 0.73
R3793:Nfrkb UTSW 9 31409932 splice site probably benign
R4020:Nfrkb UTSW 9 31414111 missense possibly damaging 0.96
R4425:Nfrkb UTSW 9 31399962 missense probably damaging 0.99
R4727:Nfrkb UTSW 9 31403623 missense probably damaging 0.99
R4730:Nfrkb UTSW 9 31410251 missense probably benign 0.33
R4775:Nfrkb UTSW 9 31419049 missense possibly damaging 0.86
R5032:Nfrkb UTSW 9 31389055 splice site probably null
R5532:Nfrkb UTSW 9 31397779 missense probably damaging 1.00
R5635:Nfrkb UTSW 9 31399298 missense probably damaging 0.98
R5712:Nfrkb UTSW 9 31414636 missense probably benign 0.00
R5720:Nfrkb UTSW 9 31394742 missense probably damaging 1.00
R6448:Nfrkb UTSW 9 31394789 missense probably damaging 1.00
R6543:Nfrkb UTSW 9 31400985 nonsense probably null
R6612:Nfrkb UTSW 9 31397006 nonsense probably null
R7087:Nfrkb UTSW 9 31419932 nonsense probably null
R7483:Nfrkb UTSW 9 31414032 nonsense probably null
R7875:Nfrkb UTSW 9 31410154 missense possibly damaging 0.53
R8336:Nfrkb UTSW 9 31403519 missense possibly damaging 0.64
R8370:Nfrkb UTSW 9 31405579 missense probably damaging 1.00
T0975:Nfrkb UTSW 9 31397083 missense probably benign 0.04
Z1088:Nfrkb UTSW 9 31411333 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TTGCCTTATAAAGCCAGGAAAGG -3'
(R):5'- TGTGGCCATCATGTCTGGAG -3'

Sequencing Primer
(F):5'- TTGAAGCTGGGTAAAGGTTATATGGC -3'
(R):5'- GAGTGATTCTCAAAACCGTCTGGC -3'
Posted On2019-05-15