Incidental Mutation 'R7123:Cfd'
ID552152
Institutional Source Beutler Lab
Gene Symbol Cfd
Ensembl Gene ENSMUSG00000061780
Gene Namecomplement factor D (adipsin)
Synonymsfactor D, D component (adipsin) of complement, Adn, DF
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R7123 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location79890853-79892655 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 79892497 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 231 (G231S)
Ref Sequence ENSEMBL: ENSMUSP00000056836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046091] [ENSMUST00000061653] [ENSMUST00000105378] [ENSMUST00000165684] [ENSMUST00000217837]
Predicted Effect probably benign
Transcript: ENSMUST00000046091
SMART Domains Protein: ENSMUSP00000038925
Gene: ENSMUSG00000020125

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Tryp_SPc 28 242 3.74e-74 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000061653
AA Change: G231S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056836
Gene: ENSMUSG00000061780
AA Change: G231S

DomainStartEndE-ValueType
Tryp_SPc 25 249 8.25e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105378
SMART Domains Protein: ENSMUSP00000101017
Gene: ENSMUSG00000013833

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
WD40 94 133 1.05e-7 SMART
Blast:WD40 143 169 4e-8 BLAST
low complexity region 206 217 N/A INTRINSIC
WD40 226 267 1.53e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165684
SMART Domains Protein: ENSMUSP00000129375
Gene: ENSMUSG00000013833

DomainStartEndE-ValueType
low complexity region 13 25 N/A INTRINSIC
WD40 95 134 1.05e-7 SMART
Blast:WD40 144 170 4e-8 BLAST
low complexity region 207 218 N/A INTRINSIC
WD40 227 268 1.53e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000217837
AA Change: G230S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: This gene encodes a serine protease that plays an important role in the alternative pathway of complement activation for pathogen recognition and elimination. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional enzyme that in turn cleaves factor B in the complement pathway. This gene is expressed in adipocytes and the mature enzyme is secreted into the bloodstream. Mice lacking the encoded product cannot initiate alternative pathway of complement activation. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele show impaired complement activation by alternative pathway activators, and increased susceptibility to pneumococcal infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik G A 13: 59,743,440 Q189* probably null Het
Abca17 A G 17: 24,265,975 I1521T probably damaging Het
Adgrv1 A T 13: 81,592,574 I145N probably damaging Het
Ago3 C A 4: 126,355,005 probably null Het
Agrn A T 4: 156,172,840 W1178R probably benign Het
Akap3 A T 6: 126,866,304 I629L probably benign Het
Aknad1 T G 3: 108,775,244 Y545* probably null Het
Anapc1 C A 2: 128,613,010 V1925F probably damaging Het
Barhl1 C T 2: 28,909,931 probably null Het
Cfap157 T C 2: 32,779,401 E294G probably damaging Het
Csf2ra A G 19: 61,226,862 V105A probably damaging Het
Dhtkd1 A T 2: 5,917,780 W523R probably damaging Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dnajc22 A C 15: 99,101,204 Y90S possibly damaging Het
Ebna1bp2 A G 4: 118,625,575 K254E probably damaging Het
Gfpt1 A T 6: 87,056,186 D131V probably damaging Het
Gm5460 A G 14: 34,042,025 I21V unknown Het
Gm7030 A G 17: 36,127,794 I235T possibly damaging Het
Htr1d C T 4: 136,442,353 probably benign Het
Kndc1 G A 7: 139,936,836 E1570K probably damaging Het
Kntc1 T C 5: 123,781,726 Y887H probably damaging Het
Kti12 T C 4: 108,848,482 S198P probably benign Het
Mcmdc2 A T 1: 9,940,418 I604F unknown Het
Mmp8 A T 9: 7,563,195 D253V probably damaging Het
Muc4 T C 16: 32,750,691 S252P possibly damaging Het
Myo5c A G 9: 75,289,223 K1317R probably benign Het
Ncoa7 T C 10: 30,654,439 I749V probably benign Het
Nfrkb A G 9: 31,414,015 probably null Het
Obscn T C 11: 59,013,651 T7166A probably benign Het
Obsl1 A G 1: 75,489,669 S1472P probably damaging Het
Olfr128 T A 17: 37,923,676 L37M probably benign Het
Olfr379-ps1 T A 11: 73,433,710 D172V unknown Het
Orc1 A C 4: 108,588,687 M1L probably damaging Het
Pkd1 T A 17: 24,594,768 S4069T possibly damaging Het
Pus1 T C 5: 110,773,932 *442W probably null Het
Rgma A C 7: 73,409,391 D97A probably damaging Het
Ryr1 T C 7: 29,046,854 K3834E probably benign Het
Sars2 T C 7: 28,753,441 V475A probably benign Het
Scamp2 A T 9: 57,587,102 T253S probably benign Het
Skint9 C T 4: 112,390,977 W190* probably null Het
Sv2b C T 7: 75,117,702 V649I possibly damaging Het
Synpo2 A G 3: 123,113,186 V827A probably benign Het
Tiparp A T 3: 65,553,527 I646F probably damaging Het
Topaz1 G A 9: 122,748,415 G130D probably damaging Het
Trio TACCTTGTTACTGAGCCCTTCTCACCTTCACAGACACCTTGTTACTGAGCCCTTCTCACCTTCACAGATACCTTGTTACTGAGCCCTTCTC TACCTTGTTACTGAGCCCTTCTCACCTTCACAGATACCTTGTTACTGAGCCCTTCTC 15: 27,742,313 probably benign Het
Ttll7 C T 3: 146,913,296 P319S possibly damaging Het
Umodl1 T A 17: 30,982,344 F416I possibly damaging Het
Vmn2r104 T C 17: 20,040,826 D445G probably benign Het
Wnk2 A G 13: 49,081,986 V651A possibly damaging Het
Zbtb21 C T 16: 97,949,912 S1057N probably damaging Het
Zfp451 A T 1: 33,776,869 C667S probably damaging Het
Other mutations in Cfd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02049:Cfd APN 10 79890942 missense probably benign
R0325:Cfd UTSW 10 79891758 nonsense probably null
R1376:Cfd UTSW 10 79892152 missense possibly damaging 0.89
R1376:Cfd UTSW 10 79892152 missense possibly damaging 0.89
R1708:Cfd UTSW 10 79891607 missense probably benign 0.00
R2221:Cfd UTSW 10 79892205 unclassified probably null
R2223:Cfd UTSW 10 79892205 unclassified probably null
R4823:Cfd UTSW 10 79890948 missense probably benign
R5388:Cfd UTSW 10 79892125 missense probably damaging 1.00
R6687:Cfd UTSW 10 79891719 missense probably damaging 0.99
R6733:Cfd UTSW 10 79891802 missense probably damaging 1.00
R7085:Cfd UTSW 10 79892492 missense probably damaging 1.00
R7451:Cfd UTSW 10 79891528 missense probably damaging 1.00
R7669:Cfd UTSW 10 79891613 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CACCATTAACATGATGTGTGCAGAG -3'
(R):5'- AGATGCACAGGGCTCAGATG -3'

Sequencing Primer
(F):5'- CACTTGCAGGGTGAGGGAC -3'
(R):5'- GCATGCATTTATTGTGAGCCAC -3'
Posted On2019-05-15