Incidental Mutation 'R7124:Madd'
ID552178
Institutional Source Beutler Lab
Gene Symbol Madd
Ensembl Gene ENSMUSG00000040687
Gene NameMAP-kinase activating death domain
SynonymsRab3 GEP, 9630059K23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7124 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location91137360-91183837 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91162048 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1093 (E1093G)
Ref Sequence ENSEMBL: ENSMUSP00000107001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066420] [ENSMUST00000066473] [ENSMUST00000075269] [ENSMUST00000077941] [ENSMUST00000099723] [ENSMUST00000099725] [ENSMUST00000111369] [ENSMUST00000111370] [ENSMUST00000111371] [ENSMUST00000111372] [ENSMUST00000111373] [ENSMUST00000111375] [ENSMUST00000111376] [ENSMUST00000111381]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066420
AA Change: E1093G

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000067210
Gene: ENSMUSG00000040687
AA Change: E1093G

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000066473
AA Change: E1093G

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000069350
Gene: ENSMUSG00000040687
AA Change: E1093G

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1334 1348 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000075269
AA Change: E1074G

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074746
Gene: ENSMUSG00000040687
AA Change: E1074G

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
low complexity region 762 770 N/A INTRINSIC
low complexity region 797 820 N/A INTRINSIC
low complexity region 889 899 N/A INTRINSIC
low complexity region 1276 1290 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000077941
AA Change: E1113G

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077094
Gene: ENSMUSG00000040687
AA Change: E1113G

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 928 938 N/A INTRINSIC
low complexity region 1354 1368 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000099723
AA Change: E1113G

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097311
Gene: ENSMUSG00000040687
AA Change: E1113G

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 928 938 N/A INTRINSIC
low complexity region 1189 1203 N/A INTRINSIC
low complexity region 1353 1367 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000099725
AA Change: E1093G

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097313
Gene: ENSMUSG00000040687
AA Change: E1093G

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1334 1348 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111369
AA Change: E1050G

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107000
Gene: ENSMUSG00000040687
AA Change: E1050G

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 721 N/A INTRINSIC
low complexity region 773 796 N/A INTRINSIC
low complexity region 865 875 N/A INTRINSIC
low complexity region 1108 1122 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111370
AA Change: E1093G

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107001
Gene: ENSMUSG00000040687
AA Change: E1093G

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1334 1348 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111371
AA Change: E1094G

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107002
Gene: ENSMUSG00000040687
AA Change: E1094G

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
low complexity region 762 770 N/A INTRINSIC
low complexity region 797 820 N/A INTRINSIC
low complexity region 909 919 N/A INTRINSIC
low complexity region 1296 1310 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111372
AA Change: E1093G

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107003
Gene: ENSMUSG00000040687
AA Change: E1093G

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1295 1309 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111373
AA Change: E1050G

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107004
Gene: ENSMUSG00000040687
AA Change: E1050G

DomainStartEndE-ValueType
uDENN 7 97 2.9e-29 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 8.7e-71 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 2.8e-16 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 721 N/A INTRINSIC
low complexity region 773 796 N/A INTRINSIC
low complexity region 865 875 N/A INTRINSIC
low complexity region 1108 1122 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111375
AA Change: E1070G

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107006
Gene: ENSMUSG00000040687
AA Change: E1070G

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 721 N/A INTRINSIC
low complexity region 773 796 N/A INTRINSIC
low complexity region 885 895 N/A INTRINSIC
low complexity region 1272 1286 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111376
AA Change: E1093G

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107007
Gene: ENSMUSG00000040687
AA Change: E1093G

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 721 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1151 1162 N/A INTRINSIC
low complexity region 1312 1326 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111381
AA Change: E1113G

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107012
Gene: ENSMUSG00000040687
AA Change: E1113G

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 928 938 N/A INTRINSIC
low complexity region 1315 1329 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Tumor necrosis factor alpha (TNF-alpha) is a signaling molecule that interacts with one of two receptors on cells targeted for apoptosis. The apoptotic signal is transduced inside these cells by cytoplasmic adaptor proteins. The protein encoded by this gene is a death domain-containing adaptor protein that interacts with the death domain of TNF-alpha receptor 1 to activate mitogen-activated protein kinase (MAPK) and propagate the apoptotic signal. It is membrane-bound and expressed at a higher level in neoplastic cells than in normal cells. Several transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die shortly after birth due to respiratory failure, are hyporesponsive to tactile stimuli, and exhibit defects in neurotransmitter release with impaired synaptic vesicle trafficking and depletion of synaptic vesicles at the neuromuscular junction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A C 3: 124,414,393 S212R probably benign Het
4930562C15Rik T C 16: 4,864,332 S170P probably benign Het
9330182O14Rik G A 15: 40,144,907 C59Y unknown Het
AA986860 A G 1: 130,742,887 E282G possibly damaging Het
Adam1a G T 5: 121,519,334 T632K probably benign Het
Aspg G T 12: 112,122,983 A402S probably damaging Het
Capn7 C T 14: 31,336,685 probably benign Het
Card9 C T 2: 26,356,884 probably null Het
Cdh13 T C 8: 118,968,173 V254A probably damaging Het
Colec10 T C 15: 54,462,371 V199A probably damaging Het
Copb2 T C 9: 98,577,053 S283P probably damaging Het
Csmd1 G T 8: 15,903,202 S3426R probably damaging Het
Cyp4f14 A G 17: 32,914,588 V98A probably benign Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dysf A G 6: 84,190,901 probably null Het
Eif4ebp1 T C 8: 27,273,419 V80A probably damaging Het
Eloa T A 4: 136,009,141 I565F probably damaging Het
Espn G T 4: 152,131,264 H513N probably benign Het
Fam83c C T 2: 155,829,571 S648N probably benign Het
Fdxr C T 11: 115,269,577 V351M probably benign Het
Fras1 A T 5: 96,714,401 D2213V probably damaging Het
Gbp4 T A 5: 105,119,959 I474F possibly damaging Het
Gm11639 T C 11: 104,738,274 F926S probably benign Het
Golgb1 T C 16: 36,913,673 V1135A probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Hipk2 A T 6: 38,818,478 Y285* probably null Het
Ifi27l2b T C 12: 103,451,320 I203V probably damaging Het
Itga10 T A 3: 96,651,765 M390K probably damaging Het
Itgb8 G T 12: 119,202,424 S124* probably null Het
Klhdc10 T A 6: 30,441,827 F173I probably damaging Het
Kng2 T G 16: 23,012,055 N168T probably damaging Het
Krtap24-1 T C 16: 88,611,546 T231A probably damaging Het
Lbx2 A T 6: 83,088,064 D194V probably damaging Het
Lrrc39 C A 3: 116,565,913 Q36K probably benign Het
Mfap3l A G 8: 60,671,269 T182A probably damaging Het
Myo9b T A 8: 71,333,701 Y670* probably null Het
Nbea A G 3: 55,992,444 L1428P probably damaging Het
Nkx2-3 T C 19: 43,614,806 Y284H possibly damaging Het
Nphp4 A G 4: 152,555,684 D1009G probably benign Het
Npy2r G A 3: 82,541,183 A95V probably damaging Het
Nuggc A G 14: 65,608,802 E70G probably damaging Het
Olfr1020 T C 2: 85,849,910 S153P probably benign Het
Olfr1028 T A 2: 85,951,473 S137T possibly damaging Het
Palld A T 8: 61,516,645 V1215D unknown Het
Pard6g T C 18: 80,117,125 I151T possibly damaging Het
Parp12 T C 6: 39,111,736 I189V probably benign Het
Parp4 A G 14: 56,602,799 I554V probably benign Het
Pcnx2 G A 8: 125,753,617 P1984S probably damaging Het
Piwil4 T C 9: 14,736,900 M128V probably benign Het
Polr2a C A 11: 69,737,462 E1302* probably null Het
Psg17 C A 7: 18,814,496 G450V probably damaging Het
Psg17 C G 7: 18,814,497 G450R probably damaging Het
Rag1 T C 2: 101,643,783 E338G probably damaging Het
Rev3l A T 10: 39,822,167 K887* probably null Het
Rragd T C 4: 32,996,027 F124S possibly damaging Het
Scube1 A T 15: 83,629,511 probably null Het
Sfpq A T 4: 127,025,932 D490V possibly damaging Het
Smc1b G T 15: 85,071,597 Q1034K probably damaging Het
Smg7 T C 1: 152,878,080 N5S probably benign Het
Spata31d1a A C 13: 59,702,487 L609R probably damaging Het
Ssh2 A G 11: 77,454,338 K1050E probably benign Het
Stab1 G A 14: 31,160,867 T393I possibly damaging Het
Sult2a4 C T 7: 13,988,395 W49* probably null Het
Thrap3 A T 4: 126,180,438 S172T unknown Het
Tmem130 A G 5: 144,750,911 V205A probably damaging Het
Ube2d2b A G 5: 107,830,851 I123V probably benign Het
Unc79 G T 12: 103,061,393 L414F probably damaging Het
Vmn2r30 C T 7: 7,334,184 S151N probably benign Het
Vmn2r54 T A 7: 12,622,151 T443S probably benign Het
Zfp229 T A 17: 21,742,616 S51T probably damaging Het
Zfp617 T C 8: 71,932,540 L238P probably damaging Het
Zfp707 T A 15: 75,973,549 C87* probably null Het
Zfp853 T C 5: 143,289,607 K101R unknown Het
Other mutations in Madd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Madd APN 2 91175766 unclassified probably benign
IGL00781:Madd APN 2 91146928 missense probably benign 0.00
IGL00844:Madd APN 2 91167868 missense probably damaging 1.00
IGL00942:Madd APN 2 91170578 missense probably damaging 1.00
IGL01100:Madd APN 2 91158040 missense probably damaging 1.00
IGL01116:Madd APN 2 91154543 splice site probably benign
IGL01694:Madd APN 2 91157975 splice site probably benign
IGL01982:Madd APN 2 91175707 missense probably damaging 1.00
IGL02346:Madd APN 2 91162491 missense probably damaging 0.97
IGL02354:Madd APN 2 91162198 missense probably benign 0.17
IGL02361:Madd APN 2 91162198 missense probably benign 0.17
IGL02481:Madd APN 2 91178036 missense probably damaging 1.00
IGL02483:Madd APN 2 91178036 missense probably damaging 1.00
IGL02948:Madd APN 2 91142827 missense probably benign
IGL03338:Madd APN 2 91162162 missense possibly damaging 0.48
R0026:Madd UTSW 2 91175708 missense possibly damaging 0.88
R0026:Madd UTSW 2 91175708 missense possibly damaging 0.88
R0027:Madd UTSW 2 91152549 missense probably damaging 0.97
R0085:Madd UTSW 2 91162738 missense probably benign 0.00
R0577:Madd UTSW 2 91138395 missense possibly damaging 0.88
R0587:Madd UTSW 2 91146885 missense probably damaging 1.00
R1112:Madd UTSW 2 91143599 missense probably damaging 1.00
R1722:Madd UTSW 2 91167637 missense probably benign
R1750:Madd UTSW 2 91167891 missense probably damaging 0.98
R2061:Madd UTSW 2 91161486 intron probably benign
R2112:Madd UTSW 2 91176976 missense possibly damaging 0.89
R2114:Madd UTSW 2 91164022 missense probably damaging 1.00
R2140:Madd UTSW 2 91152509 missense possibly damaging 0.80
R2276:Madd UTSW 2 91143683 missense possibly damaging 0.67
R2277:Madd UTSW 2 91143683 missense possibly damaging 0.67
R2279:Madd UTSW 2 91143683 missense possibly damaging 0.67
R2424:Madd UTSW 2 91166622 missense probably damaging 1.00
R2904:Madd UTSW 2 91175672 missense probably damaging 1.00
R3122:Madd UTSW 2 91176209 missense probably damaging 1.00
R3836:Madd UTSW 2 91154643 critical splice donor site probably null
R3979:Madd UTSW 2 91176828 missense possibly damaging 0.81
R4151:Madd UTSW 2 91143083 missense probably benign 0.11
R4233:Madd UTSW 2 91178236 missense probably benign 0.26
R4236:Madd UTSW 2 91167028 missense probably benign 0.00
R4299:Madd UTSW 2 91169803 missense probably damaging 1.00
R4334:Madd UTSW 2 91140572 missense probably benign 0.08
R4413:Madd UTSW 2 91167587 missense probably damaging 1.00
R4595:Madd UTSW 2 91167664 missense possibly damaging 0.80
R4694:Madd UTSW 2 91160328 missense probably damaging 0.99
R5410:Madd UTSW 2 91154514 missense probably damaging 1.00
R5490:Madd UTSW 2 91170635 missense possibly damaging 0.80
R5560:Madd UTSW 2 91163545 missense probably damaging 1.00
R5661:Madd UTSW 2 91154433 critical splice donor site probably null
R5710:Madd UTSW 2 91154476 missense probably damaging 1.00
R5730:Madd UTSW 2 91158109 missense probably damaging 1.00
R5759:Madd UTSW 2 91162075 missense possibly damaging 0.94
R5768:Madd UTSW 2 91167829 missense probably damaging 1.00
R5822:Madd UTSW 2 91152533 missense probably damaging 1.00
R6125:Madd UTSW 2 91152452 critical splice donor site probably null
R6151:Madd UTSW 2 91165457 nonsense probably null
R6229:Madd UTSW 2 91143670 missense probably damaging 0.96
R6230:Madd UTSW 2 91143521 critical splice donor site probably null
R6245:Madd UTSW 2 91178104 missense probably benign 0.27
R6323:Madd UTSW 2 91161438 utr 3 prime probably null
R6456:Madd UTSW 2 91178191 missense probably benign
R6473:Madd UTSW 2 91167059 missense probably benign
R6878:Madd UTSW 2 91169857 missense probably damaging 1.00
R7060:Madd UTSW 2 91177107 missense probably damaging 1.00
R7065:Madd UTSW 2 91155057 missense probably benign 0.26
R7073:Madd UTSW 2 91162509 missense probably damaging 1.00
R7251:Madd UTSW 2 91162176 missense probably benign 0.01
R7510:Madd UTSW 2 91177976 missense possibly damaging 0.80
R7605:Madd UTSW 2 91169710 missense possibly damaging 0.90
X0067:Madd UTSW 2 91152473 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAAAGATGCTGGTGAGGCG -3'
(R):5'- GTTCCTTTCCTCAGAACCAGAC -3'

Sequencing Primer
(F):5'- TGCGGGTAAGAAAATGCTCCTG -3'
(R):5'- TTTCCTCAGAACCAGACAAACGG -3'
Posted On2019-05-15