Mutagenetix > Incidental Mutation

Incidental Mutation 'R7124:Itga10'

552183

Institutional Source

Beutler Lab

Gene Symbol

Itga10

Ensembl Gene

ENSMUSG00000090210

Gene Name

integrin, alpha 10

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.234) question?

Stock #

R7124 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

96645584-96664519 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 96651765 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 390 (M390K)

Ref Sequence

ENSEMBL: ENSMUSP00000112393 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029744] [ENSMUST00000119365] [ENSMUST00000137564]

AlphaFold

E9Q6R1

Predicted Effect

probably damaging
Transcript: ENSMUST00000029744
AA Change: M390K

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000029744
Gene: ENSMUSG00000090210
AA Change: M390K

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Int_alpha	37	93	9.03e-3	SMART
VWA	165	355	9.6e-43	SMART
Int_alpha	427	481	2.01e0	SMART
Int_alpha	482	539	5.14e-7	SMART
Int_alpha	545	600	5.34e-14	SMART
Int_alpha	607	652	8.75e0	SMART
transmembrane domain	1123	1145	N/A	INTRINSIC
low complexity region	1153	1166	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000119365
AA Change: M390K

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000112393
Gene: ENSMUSG00000090210
AA Change: M390K

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Int_alpha	37	93	9.03e-3	SMART
VWA	165	355	9.6e-43	SMART
Int_alpha	427	481	2.01e0	SMART
Int_alpha	482	539	5.14e-7	SMART
Int_alpha	545	600	5.34e-14	SMART
Int_alpha	607	652	8.75e0	SMART
transmembrane domain	1122	1144	N/A	INTRINSIC
low complexity region	1152	1165	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000137564

SMART Domains

Protein: ENSMUSP00000121011
Gene: ENSMUSG00000106447

Domain	Start	End	E-Value	Type
Pfam:PEX11	1	172	4.5e-57	PFAM
low complexity region	186	204	N/A	INTRINSIC
Int_alpha	222	278	9.03e-3	SMART
Blast:VWA	292	345	3e-7	BLAST

Meta Mutation Damage Score

0.1739

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

97% (72/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are integral transmembrane glycoproteins composed of noncovalently linked alpha and beta chains. They participate in cell adhesion as well as cell-surface mediated signalling. This gene encodes an integrin alpha chain and is expressed at high levels in chondrocytes, where it is transcriptionally regulated by AP-2epsilon and Ets-1. The protein encoded by this gene binds to collagen. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous null mice display slightly shortened long bones and amild abnormalities in ephysiseal plate morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	C	3: 124,414,393	S212R	probably benign	Het
4930562C15Rik	T	C	16: 4,864,332	S170P	probably benign	Het
9330182O14Rik	G	A	15: 40,144,907	C59Y	unknown	Het
AA986860	A	G	1: 130,742,887	E282G	possibly damaging	Het
Adam1a	G	T	5: 121,519,334	T632K	probably benign	Het
Aspg	G	T	12: 112,122,983	A402S	probably damaging	Het
Capn7	C	T	14: 31,336,685		probably benign	Het
Card9	C	T	2: 26,356,884		probably null	Het
Cdh13	T	C	8: 118,968,173	V254A	probably damaging	Het
Colec10	T	C	15: 54,462,371	V199A	probably damaging	Het
Copb2	T	C	9: 98,577,053	S283P	probably damaging	Het
Csmd1	G	T	8: 15,903,202	S3426R	probably damaging	Het
Cyp4f14	A	G	17: 32,914,588	V98A	probably benign	Het
Disp1	C	A	1: 183,087,466	R1130L	probably damaging	Het
Dysf	A	G	6: 84,190,901		probably null	Het
Eif4ebp1	T	C	8: 27,273,419	V80A	probably damaging	Het
Eloa	T	A	4: 136,009,141	I565F	probably damaging	Het
Espn	G	T	4: 152,131,264	H513N	probably benign	Het
Fam83c	C	T	2: 155,829,571	S648N	probably benign	Het
Fdxr	C	T	11: 115,269,577	V351M	probably benign	Het
Fras1	A	T	5: 96,714,401	D2213V	probably damaging	Het
Gbp4	T	A	5: 105,119,959	I474F	possibly damaging	Het
Gm11639	T	C	11: 104,738,274	F926S	probably benign	Het
Golgb1	T	C	16: 36,913,673	V1135A	probably benign	Het
Gpt2	G	A	8: 85,518,052	E325K	probably benign	Het
Hipk2	A	T	6: 38,818,478	Y285*	probably null	Het
Ifi27l2b	T	C	12: 103,451,320	I203V	probably damaging	Het
Itgb8	G	T	12: 119,202,424	S124*	probably null	Het
Klhdc10	T	A	6: 30,441,827	F173I	probably damaging	Het
Kng2	T	G	16: 23,012,055	N168T	probably damaging	Het
Krtap24-1	T	C	16: 88,611,546	T231A	probably damaging	Het
Lbx2	A	T	6: 83,088,064	D194V	probably damaging	Het
Lrrc39	C	A	3: 116,565,913	Q36K	probably benign	Het
Madd	T	C	2: 91,162,048	E1093G	possibly damaging	Het
Mfap3l	A	G	8: 60,671,269	T182A	probably damaging	Het
Myo9b	T	A	8: 71,333,701	Y670*	probably null	Het
Nbea	A	G	3: 55,992,444	L1428P	probably damaging	Het
Nkx2-3	T	C	19: 43,614,806	Y284H	possibly damaging	Het
Nphp4	A	G	4: 152,555,684	D1009G	probably benign	Het
Npy2r	G	A	3: 82,541,183	A95V	probably damaging	Het
Nuggc	A	G	14: 65,608,802	E70G	probably damaging	Het
Olfr1020	T	C	2: 85,849,910	S153P	probably benign	Het
Olfr1028	T	A	2: 85,951,473	S137T	possibly damaging	Het
Palld	A	T	8: 61,516,645	V1215D	unknown	Het
Pard6g	T	C	18: 80,117,125	I151T	possibly damaging	Het
Parp12	T	C	6: 39,111,736	I189V	probably benign	Het
Parp4	A	G	14: 56,602,799	I554V	probably benign	Het
Pcnx2	G	A	8: 125,753,617	P1984S	probably damaging	Het
Piwil4	T	C	9: 14,736,900	M128V	probably benign	Het
Polr2a	C	A	11: 69,737,462	E1302*	probably null	Het
Psg17	C	A	7: 18,814,496	G450V	probably damaging	Het
Psg17	C	G	7: 18,814,497	G450R	probably damaging	Het
Rag1	T	C	2: 101,643,783	E338G	probably damaging	Het
Rev3l	A	T	10: 39,822,167	K887*	probably null	Het
Rragd	T	C	4: 32,996,027	F124S	possibly damaging	Het
Scube1	A	T	15: 83,629,511		probably null	Het
Sfpq	A	T	4: 127,025,932	D490V	possibly damaging	Het
Smc1b	G	T	15: 85,071,597	Q1034K	probably damaging	Het
Smg7	T	C	1: 152,878,080	N5S	probably benign	Het
Spata31d1a	A	C	13: 59,702,487	L609R	probably damaging	Het
Ssh2	A	G	11: 77,454,338	K1050E	probably benign	Het
Stab1	G	A	14: 31,160,867	T393I	possibly damaging	Het
Sult2a4	C	T	7: 13,988,395	W49*	probably null	Het
Thrap3	A	T	4: 126,180,438	S172T	unknown	Het
Tmem130	A	G	5: 144,750,911	V205A	probably damaging	Het
Ube2d2b	A	G	5: 107,830,851	I123V	probably benign	Het
Unc79	G	T	12: 103,061,393	L414F	probably damaging	Het
Vmn2r30	C	T	7: 7,334,184	S151N	probably benign	Het
Vmn2r54	T	A	7: 12,622,151	T443S	probably benign	Het
Zfp229	T	A	17: 21,742,616	S51T	probably damaging	Het
Zfp617	T	C	8: 71,932,540	L238P	probably damaging	Het
Zfp707	T	A	15: 75,973,549	C87*	probably null	Het
Zfp853	T	C	5: 143,289,607	K101R	unknown	Het

Other mutations in Itga10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01473:Itga10	APN	3	96647641	missense	probably damaging	0.96
IGL01694:Itga10	APN	3	96652517	missense	probably damaging	0.99
IGL01754:Itga10	APN	3	96656775	unclassified	probably benign
IGL02527:Itga10	APN	3	96655624	unclassified	probably benign
IGL02956:Itga10	APN	3	96655113	missense	possibly damaging	0.46
IGL03371:Itga10	APN	3	96654788	missense	possibly damaging	0.84
IGL03055:Itga10	UTSW	3	96650520	missense	probably damaging	0.99
PIT4515001:Itga10	UTSW	3	96662632	missense	probably damaging	0.99
R0153:Itga10	UTSW	3	96653700	missense	probably benign	0.00
R0308:Itga10	UTSW	3	96651464	missense	probably damaging	1.00
R0331:Itga10	UTSW	3	96652483	missense	probably damaging	1.00
R0413:Itga10	UTSW	3	96649059	missense	probably damaging	1.00
R0437:Itga10	UTSW	3	96649137	missense	probably damaging	1.00
R0511:Itga10	UTSW	3	96658174	missense	probably damaging	1.00
R0630:Itga10	UTSW	3	96656299	unclassified	probably benign
R0844:Itga10	UTSW	3	96651738	splice site	probably benign
R0849:Itga10	UTSW	3	96652530	missense	possibly damaging	0.67
R0894:Itga10	UTSW	3	96653660	missense	possibly damaging	0.69
R0919:Itga10	UTSW	3	96651738	splice site	probably benign
R1027:Itga10	UTSW	3	96651738	splice site	probably benign
R1341:Itga10	UTSW	3	96652495	missense	probably damaging	1.00
R1350:Itga10	UTSW	3	96657477	missense	probably benign	0.01
R1370:Itga10	UTSW	3	96651738	splice site	probably benign
R1467:Itga10	UTSW	3	96652229	nonsense	probably null
R1467:Itga10	UTSW	3	96652229	nonsense	probably null
R1589:Itga10	UTSW	3	96651738	splice site	probably benign
R1590:Itga10	UTSW	3	96651738	splice site	probably benign
R1601:Itga10	UTSW	3	96653658	missense	possibly damaging	0.82
R1659:Itga10	UTSW	3	96662977	missense	probably damaging	0.96
R1665:Itga10	UTSW	3	96651738	splice site	probably benign
R1667:Itga10	UTSW	3	96651738	splice site	probably benign
R1686:Itga10	UTSW	3	96651825	missense	probably damaging	0.97
R1972:Itga10	UTSW	3	96651738	splice site	probably benign
R1976:Itga10	UTSW	3	96651738	splice site	probably benign
R2020:Itga10	UTSW	3	96652490	missense	probably damaging	1.00
R2040:Itga10	UTSW	3	96651738	splice site	probably benign
R2044:Itga10	UTSW	3	96651738	splice site	probably benign
R2044:Itga10	UTSW	3	96657690	missense	probably benign
R2045:Itga10	UTSW	3	96651738	splice site	probably benign
R2060:Itga10	UTSW	3	96654998	nonsense	probably null
R2146:Itga10	UTSW	3	96651492	missense	possibly damaging	0.59
R2146:Itga10	UTSW	3	96653723	missense	probably damaging	1.00
R2170:Itga10	UTSW	3	96650457	missense	probably damaging	1.00
R2893:Itga10	UTSW	3	96655100	missense	probably benign	0.11
R2926:Itga10	UTSW	3	96652849	missense	probably damaging	1.00
R3622:Itga10	UTSW	3	96651738	splice site	probably benign
R3623:Itga10	UTSW	3	96651738	splice site	probably benign
R4416:Itga10	UTSW	3	96658246	missense	possibly damaging	0.58
R4633:Itga10	UTSW	3	96647704	missense	possibly damaging	0.92
R5074:Itga10	UTSW	3	96652211	nonsense	probably null
R5095:Itga10	UTSW	3	96648164	missense	probably benign	0.21
R5495:Itga10	UTSW	3	96647371	missense	possibly damaging	0.92
R5813:Itga10	UTSW	3	96652585	missense	probably benign	0.38
R6114:Itga10	UTSW	3	96649035	missense	probably damaging	1.00
R6172:Itga10	UTSW	3	96647437	missense	probably benign	0.18
R6275:Itga10	UTSW	3	96658185	missense	probably benign	0.36
R6298:Itga10	UTSW	3	96656762	missense	probably benign	0.00
R6433:Itga10	UTSW	3	96658041	critical splice donor site	probably null
R6841:Itga10	UTSW	3	96656714	missense	probably damaging	1.00
R6909:Itga10	UTSW	3	96662599	missense	probably benign	0.00
R6927:Itga10	UTSW	3	96656714	missense	probably damaging	1.00
R7310:Itga10	UTSW	3	96648159	missense	probably damaging	1.00
R7387:Itga10	UTSW	3	96652778	missense	probably benign	0.11
R7464:Itga10	UTSW	3	96648155	missense	probably damaging	1.00
R7624:Itga10	UTSW	3	96652953	missense	probably benign
R7638:Itga10	UTSW	3	96657391	splice site	probably null
R7639:Itga10	UTSW	3	96649582	missense	probably benign	0.36
R7893:Itga10	UTSW	3	96649612	missense	probably damaging	1.00
R8297:Itga10	UTSW	3	96654800	missense	probably damaging	1.00
R8753:Itga10	UTSW	3	96651155	missense	probably damaging	1.00
R9526:Itga10	UTSW	3	96656957	missense	probably damaging	1.00
X0064:Itga10	UTSW	3	96652936	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- AGGTTGGATAGACCCTGACC -3'
(R):5'- CTGAGTGACAAAGTGCATGAGC -3'

Sequencing Primer
(F):5'- GGATAGACCCTGACCCTCTC -3'
(R):5'- TAAGGGGGAGTGCCTCATACC -3'

Posted On

2019-05-15