Incidental Mutation 'R7124:Lrrc39'
ID552184
Institutional Source Beutler Lab
Gene Symbol Lrrc39
Ensembl Gene ENSMUSG00000027961
Gene Nameleucine rich repeat containing 39
Synonyms2010005E21Rik, 9430028I06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.543) question?
Stock #R7124 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location116562973-116583134 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 116565913 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 36 (Q36K)
Ref Sequence ENSEMBL: ENSMUSP00000029573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029573]
Predicted Effect probably benign
Transcript: ENSMUST00000029573
AA Change: Q36K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029573
Gene: ENSMUSG00000027961
AA Change: Q36K

DomainStartEndE-ValueType
LRR 105 127 1.15e1 SMART
LRR_TYP 128 151 7.26e-3 SMART
LRR 175 197 6.58e0 SMART
LRR 198 220 1e1 SMART
LRR 221 243 7.16e0 SMART
LRR 244 267 6.58e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 97% (72/74)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A C 3: 124,414,393 S212R probably benign Het
4930562C15Rik T C 16: 4,864,332 S170P probably benign Het
9330182O14Rik G A 15: 40,144,907 C59Y unknown Het
AA986860 A G 1: 130,742,887 E282G possibly damaging Het
Adam1a G T 5: 121,519,334 T632K probably benign Het
Aspg G T 12: 112,122,983 A402S probably damaging Het
Capn7 C T 14: 31,336,685 probably benign Het
Card9 C T 2: 26,356,884 probably null Het
Cdh13 T C 8: 118,968,173 V254A probably damaging Het
Colec10 T C 15: 54,462,371 V199A probably damaging Het
Copb2 T C 9: 98,577,053 S283P probably damaging Het
Csmd1 G T 8: 15,903,202 S3426R probably damaging Het
Cyp4f14 A G 17: 32,914,588 V98A probably benign Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dysf A G 6: 84,190,901 probably null Het
Eif4ebp1 T C 8: 27,273,419 V80A probably damaging Het
Eloa T A 4: 136,009,141 I565F probably damaging Het
Espn G T 4: 152,131,264 H513N probably benign Het
Fam83c C T 2: 155,829,571 S648N probably benign Het
Fdxr C T 11: 115,269,577 V351M probably benign Het
Fras1 A T 5: 96,714,401 D2213V probably damaging Het
Gbp4 T A 5: 105,119,959 I474F possibly damaging Het
Gm11639 T C 11: 104,738,274 F926S probably benign Het
Golgb1 T C 16: 36,913,673 V1135A probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Hipk2 A T 6: 38,818,478 Y285* probably null Het
Ifi27l2b T C 12: 103,451,320 I203V probably damaging Het
Itga10 T A 3: 96,651,765 M390K probably damaging Het
Itgb8 G T 12: 119,202,424 S124* probably null Het
Klhdc10 T A 6: 30,441,827 F173I probably damaging Het
Kng2 T G 16: 23,012,055 N168T probably damaging Het
Krtap24-1 T C 16: 88,611,546 T231A probably damaging Het
Lbx2 A T 6: 83,088,064 D194V probably damaging Het
Madd T C 2: 91,162,048 E1093G possibly damaging Het
Mfap3l A G 8: 60,671,269 T182A probably damaging Het
Myo9b T A 8: 71,333,701 Y670* probably null Het
Nbea A G 3: 55,992,444 L1428P probably damaging Het
Nkx2-3 T C 19: 43,614,806 Y284H possibly damaging Het
Nphp4 A G 4: 152,555,684 D1009G probably benign Het
Npy2r G A 3: 82,541,183 A95V probably damaging Het
Nuggc A G 14: 65,608,802 E70G probably damaging Het
Olfr1020 T C 2: 85,849,910 S153P probably benign Het
Olfr1028 T A 2: 85,951,473 S137T possibly damaging Het
Palld A T 8: 61,516,645 V1215D unknown Het
Pard6g T C 18: 80,117,125 I151T possibly damaging Het
Parp12 T C 6: 39,111,736 I189V probably benign Het
Parp4 A G 14: 56,602,799 I554V probably benign Het
Pcnx2 G A 8: 125,753,617 P1984S probably damaging Het
Piwil4 T C 9: 14,736,900 M128V probably benign Het
Polr2a C A 11: 69,737,462 E1302* probably null Het
Psg17 C A 7: 18,814,496 G450V probably damaging Het
Psg17 C G 7: 18,814,497 G450R probably damaging Het
Rag1 T C 2: 101,643,783 E338G probably damaging Het
Rev3l A T 10: 39,822,167 K887* probably null Het
Rragd T C 4: 32,996,027 F124S possibly damaging Het
Scube1 A T 15: 83,629,511 probably null Het
Sfpq A T 4: 127,025,932 D490V possibly damaging Het
Smc1b G T 15: 85,071,597 Q1034K probably damaging Het
Smg7 T C 1: 152,878,080 N5S probably benign Het
Spata31d1a A C 13: 59,702,487 L609R probably damaging Het
Ssh2 A G 11: 77,454,338 K1050E probably benign Het
Stab1 G A 14: 31,160,867 T393I possibly damaging Het
Sult2a4 C T 7: 13,988,395 W49* probably null Het
Thrap3 A T 4: 126,180,438 S172T unknown Het
Tmem130 A G 5: 144,750,911 V205A probably damaging Het
Ube2d2b A G 5: 107,830,851 I123V probably benign Het
Unc79 G T 12: 103,061,393 L414F probably damaging Het
Vmn2r30 C T 7: 7,334,184 S151N probably benign Het
Vmn2r54 T A 7: 12,622,151 T443S probably benign Het
Zfp229 T A 17: 21,742,616 S51T probably damaging Het
Zfp617 T C 8: 71,932,540 L238P probably damaging Het
Zfp707 T A 15: 75,973,549 C87* probably null Het
Zfp853 T C 5: 143,289,607 K101R unknown Het
Other mutations in Lrrc39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Lrrc39 APN 3 116570981 splice site probably benign
IGL01017:Lrrc39 APN 3 116570851 missense probably benign 0.01
IGL01717:Lrrc39 APN 3 116579497 unclassified probably benign
IGL01728:Lrrc39 APN 3 116579500 unclassified probably benign
IGL02208:Lrrc39 APN 3 116578274 missense probably damaging 1.00
IGL02801:Lrrc39 APN 3 116578346 missense possibly damaging 0.89
R0279:Lrrc39 UTSW 3 116578303 missense probably benign 0.19
R1351:Lrrc39 UTSW 3 116565820 missense possibly damaging 0.51
R1436:Lrrc39 UTSW 3 116579644 splice site probably null
R1641:Lrrc39 UTSW 3 116570913 missense probably damaging 0.99
R1716:Lrrc39 UTSW 3 116579567 missense probably benign 0.00
R2199:Lrrc39 UTSW 3 116570961 missense probably damaging 0.97
R2410:Lrrc39 UTSW 3 116581250 missense probably benign 0.02
R4696:Lrrc39 UTSW 3 116570120 missense probably damaging 1.00
R4816:Lrrc39 UTSW 3 116568866 critical splice donor site probably null
R5076:Lrrc39 UTSW 3 116579540 missense probably benign 0.37
R6152:Lrrc39 UTSW 3 116570975 critical splice donor site probably null
R8855:Lrrc39 UTSW 3 116570141 missense probably damaging 1.00
R8866:Lrrc39 UTSW 3 116570141 missense probably damaging 1.00
X0028:Lrrc39 UTSW 3 116565871 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGGTGTCCTGTGACTCAG -3'
(R):5'- TTCTAGCAGATCCAGTGCCC -3'

Sequencing Primer
(F):5'- GTGACTCAGCTCTTCAGAACG -3'
(R):5'- GTACCTGCACAAATATGGATAGAC -3'
Posted On2019-05-15