Incidental Mutation 'R7124:Nphp4'
ID 552191
Institutional Source Beutler Lab
Gene Symbol Nphp4
Ensembl Gene ENSMUSG00000039577
Gene Name nephronophthisis 4 (juvenile) homolog (human)
Synonyms nmf192, 4930564O18Rik
MMRRC Submission 045212-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.142) question?
Stock # R7124 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 152561163-152647640 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 152640141 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1009 (D1009G)
Ref Sequence ENSEMBL: ENSMUSP00000080128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056567] [ENSMUST00000081393]
AlphaFold P59240
Predicted Effect probably benign
Transcript: ENSMUST00000056567
AA Change: D1009G

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000049920
Gene: ENSMUSG00000039577
AA Change: D1009G

DomainStartEndE-ValueType
low complexity region 317 333 N/A INTRINSIC
low complexity region 367 380 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 507 530 N/A INTRINSIC
low complexity region 896 909 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081393
AA Change: D1009G

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000080128
Gene: ENSMUSG00000039577
AA Change: D1009G

DomainStartEndE-ValueType
low complexity region 317 333 N/A INTRINSIC
low complexity region 367 380 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 507 530 N/A INTRINSIC
low complexity region 896 909 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142027
Meta Mutation Damage Score 0.1519 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in renal tubular development and function. This protein interacts with nephrocystin, and belongs to a multifunctional complex that is localized to actin- and microtubule-based structures. Mutations in this gene are associated with nephronophthisis type 4, a renal disease, and with Senior-Loken syndrome type 4, a combination of nephronophthisis and retinitis pigmentosa. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mutant mice have a mottled retina with photoreceptor degeneration and male infertility associated with oligozoospermia and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A C 3: 124,208,042 (GRCm39) S212R probably benign Het
4930562C15Rik T C 16: 4,682,196 (GRCm39) S170P probably benign Het
9330182O14Rik G A 15: 40,008,303 (GRCm39) C59Y unknown Het
AA986860 A G 1: 130,670,624 (GRCm39) E282G possibly damaging Het
Adam1a G T 5: 121,657,397 (GRCm39) T632K probably benign Het
Aspg G T 12: 112,089,417 (GRCm39) A402S probably damaging Het
Capn7 C T 14: 31,058,642 (GRCm39) probably benign Het
Card9 C T 2: 26,246,896 (GRCm39) probably null Het
Cdh13 T C 8: 119,694,912 (GRCm39) V254A probably damaging Het
Colec10 T C 15: 54,325,767 (GRCm39) V199A probably damaging Het
Copb2 T C 9: 98,459,106 (GRCm39) S283P probably damaging Het
Csmd1 G T 8: 15,953,202 (GRCm39) S3426R probably damaging Het
Cyp4f14 A G 17: 33,133,562 (GRCm39) V98A probably benign Het
Disp1 C A 1: 182,869,030 (GRCm39) R1130L probably damaging Het
Dysf A G 6: 84,167,883 (GRCm39) probably null Het
Efcab3 T C 11: 104,629,100 (GRCm39) F926S probably benign Het
Eif4ebp1 T C 8: 27,763,447 (GRCm39) V80A probably damaging Het
Eloa T A 4: 135,736,452 (GRCm39) I565F probably damaging Het
Espn G T 4: 152,215,721 (GRCm39) H513N probably benign Het
Fam83c C T 2: 155,671,491 (GRCm39) S648N probably benign Het
Fdxr C T 11: 115,160,403 (GRCm39) V351M probably benign Het
Fras1 A T 5: 96,862,260 (GRCm39) D2213V probably damaging Het
Gbp4 T A 5: 105,267,825 (GRCm39) I474F possibly damaging Het
Golgb1 T C 16: 36,734,035 (GRCm39) V1135A probably benign Het
Gpt2 G A 8: 86,244,681 (GRCm39) E325K probably benign Het
Hipk2 A T 6: 38,795,413 (GRCm39) Y285* probably null Het
Ifi27l2b T C 12: 103,417,579 (GRCm39) I203V probably damaging Het
Itga10 T A 3: 96,559,081 (GRCm39) M390K probably damaging Het
Itgb8 G T 12: 119,166,159 (GRCm39) S124* probably null Het
Klhdc10 T A 6: 30,441,826 (GRCm39) F173I probably damaging Het
Kng2 T G 16: 22,830,805 (GRCm39) N168T probably damaging Het
Krtap24-1 T C 16: 88,408,434 (GRCm39) T231A probably damaging Het
Lbx2 A T 6: 83,065,045 (GRCm39) D194V probably damaging Het
Lrrc39 C A 3: 116,359,562 (GRCm39) Q36K probably benign Het
Madd T C 2: 90,992,393 (GRCm39) E1093G possibly damaging Het
Mfap3l A G 8: 61,124,303 (GRCm39) T182A probably damaging Het
Myo9b T A 8: 71,786,345 (GRCm39) Y670* probably null Het
Nbea A G 3: 55,899,865 (GRCm39) L1428P probably damaging Het
Nkx2-3 T C 19: 43,603,245 (GRCm39) Y284H possibly damaging Het
Npy2r G A 3: 82,448,490 (GRCm39) A95V probably damaging Het
Nuggc A G 14: 65,846,251 (GRCm39) E70G probably damaging Het
Or5ap2 T C 2: 85,680,254 (GRCm39) S153P probably benign Het
Or5m11 T A 2: 85,781,817 (GRCm39) S137T possibly damaging Het
Palld A T 8: 61,969,679 (GRCm39) V1215D unknown Het
Pard6g T C 18: 80,160,340 (GRCm39) I151T possibly damaging Het
Parp12 T C 6: 39,088,670 (GRCm39) I189V probably benign Het
Parp4 A G 14: 56,840,256 (GRCm39) I554V probably benign Het
Pcnx2 G A 8: 126,480,356 (GRCm39) P1984S probably damaging Het
Piwil4 T C 9: 14,648,196 (GRCm39) M128V probably benign Het
Polr2a C A 11: 69,628,288 (GRCm39) E1302* probably null Het
Psg17 C A 7: 18,548,421 (GRCm39) G450V probably damaging Het
Psg17 C G 7: 18,548,422 (GRCm39) G450R probably damaging Het
Rag1 T C 2: 101,474,128 (GRCm39) E338G probably damaging Het
Rev3l A T 10: 39,698,163 (GRCm39) K887* probably null Het
Rragd T C 4: 32,996,027 (GRCm39) F124S possibly damaging Het
Scube1 A T 15: 83,513,712 (GRCm39) probably null Het
Sfpq A T 4: 126,919,725 (GRCm39) D490V possibly damaging Het
Smc1b G T 15: 84,955,798 (GRCm39) Q1034K probably damaging Het
Smg7 T C 1: 152,753,831 (GRCm39) N5S probably benign Het
Spata31d1a A C 13: 59,850,301 (GRCm39) L609R probably damaging Het
Ssh2 A G 11: 77,345,164 (GRCm39) K1050E probably benign Het
Stab1 G A 14: 30,882,824 (GRCm39) T393I possibly damaging Het
Sult2a4 C T 7: 13,722,320 (GRCm39) W49* probably null Het
Thrap3 A T 4: 126,074,231 (GRCm39) S172T unknown Het
Tmem130 A G 5: 144,687,721 (GRCm39) V205A probably damaging Het
Ube2d2b A G 5: 107,978,717 (GRCm39) I123V probably benign Het
Unc79 G T 12: 103,027,652 (GRCm39) L414F probably damaging Het
Vmn2r30 C T 7: 7,337,183 (GRCm39) S151N probably benign Het
Vmn2r54 T A 7: 12,356,078 (GRCm39) T443S probably benign Het
Zfp229 T A 17: 21,961,597 (GRCm39) S51T probably damaging Het
Zfp617 T C 8: 72,686,384 (GRCm39) L238P probably damaging Het
Zfp707 T A 15: 75,845,398 (GRCm39) C87* probably null Het
Zfp853 T C 5: 143,275,362 (GRCm39) K101R unknown Het
Other mutations in Nphp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Nphp4 APN 4 152,621,766 (GRCm39) splice site probably benign
IGL00963:Nphp4 APN 4 152,622,318 (GRCm39) missense probably benign 0.01
IGL01571:Nphp4 APN 4 152,640,839 (GRCm39) missense probably benign 0.21
IGL01707:Nphp4 APN 4 152,623,440 (GRCm39) missense probably benign 0.00
IGL01837:Nphp4 APN 4 152,573,338 (GRCm39) missense probably damaging 0.96
IGL02341:Nphp4 APN 4 152,639,926 (GRCm39) splice site probably benign
IGL02558:Nphp4 APN 4 152,639,988 (GRCm39) missense probably damaging 1.00
IGL02563:Nphp4 APN 4 152,640,677 (GRCm39) missense probably benign 0.00
IGL02712:Nphp4 APN 4 152,640,732 (GRCm39) missense probably damaging 1.00
IGL03023:Nphp4 APN 4 152,608,692 (GRCm39) splice site probably null
R0280:Nphp4 UTSW 4 152,636,393 (GRCm39) splice site probably benign
R0317:Nphp4 UTSW 4 152,636,388 (GRCm39) critical splice donor site probably null
R0410:Nphp4 UTSW 4 152,641,503 (GRCm39) missense probably benign
R0433:Nphp4 UTSW 4 152,602,629 (GRCm39) missense probably benign 0.00
R0706:Nphp4 UTSW 4 152,640,074 (GRCm39) missense probably damaging 0.98
R0785:Nphp4 UTSW 4 152,646,566 (GRCm39) missense possibly damaging 0.58
R0890:Nphp4 UTSW 4 152,582,677 (GRCm39) missense possibly damaging 0.93
R0930:Nphp4 UTSW 4 152,622,512 (GRCm39) missense probably benign 0.01
R1202:Nphp4 UTSW 4 152,573,186 (GRCm39) splice site probably null
R1203:Nphp4 UTSW 4 152,573,289 (GRCm39) missense probably damaging 0.96
R1366:Nphp4 UTSW 4 152,587,383 (GRCm39) missense probably damaging 0.96
R1452:Nphp4 UTSW 4 152,631,475 (GRCm39) missense probably damaging 0.99
R1598:Nphp4 UTSW 4 152,646,547 (GRCm39) missense probably benign 0.00
R1699:Nphp4 UTSW 4 152,581,121 (GRCm39) missense probably damaging 0.99
R2007:Nphp4 UTSW 4 152,639,111 (GRCm39) missense probably damaging 0.97
R2082:Nphp4 UTSW 4 152,643,821 (GRCm39) missense probably benign 0.38
R2264:Nphp4 UTSW 4 152,587,465 (GRCm39) splice site probably benign
R2280:Nphp4 UTSW 4 152,641,500 (GRCm39) missense possibly damaging 0.95
R2281:Nphp4 UTSW 4 152,641,500 (GRCm39) missense possibly damaging 0.95
R2926:Nphp4 UTSW 4 152,602,596 (GRCm39) missense probably damaging 0.99
R3764:Nphp4 UTSW 4 152,622,474 (GRCm39) splice site probably benign
R4084:Nphp4 UTSW 4 152,573,248 (GRCm39) missense probably damaging 1.00
R4091:Nphp4 UTSW 4 152,631,475 (GRCm39) missense probably damaging 0.97
R4240:Nphp4 UTSW 4 152,640,141 (GRCm39) missense probably benign 0.07
R4701:Nphp4 UTSW 4 152,581,116 (GRCm39) missense probably damaging 1.00
R4778:Nphp4 UTSW 4 152,640,748 (GRCm39) missense probably benign 0.44
R4783:Nphp4 UTSW 4 152,639,003 (GRCm39) missense probably benign 0.00
R4784:Nphp4 UTSW 4 152,639,003 (GRCm39) missense probably benign 0.00
R4974:Nphp4 UTSW 4 152,622,250 (GRCm39) missense probably damaging 1.00
R5053:Nphp4 UTSW 4 152,628,919 (GRCm39) splice site probably null
R5117:Nphp4 UTSW 4 152,608,689 (GRCm39) splice site probably null
R5128:Nphp4 UTSW 4 152,587,448 (GRCm39) missense probably benign 0.01
R5665:Nphp4 UTSW 4 152,590,942 (GRCm39) missense probably benign 0.25
R5890:Nphp4 UTSW 4 152,631,536 (GRCm39) missense probably benign 0.44
R6171:Nphp4 UTSW 4 152,628,906 (GRCm39) missense probably damaging 0.99
R6601:Nphp4 UTSW 4 152,587,464 (GRCm39) splice site probably null
R6772:Nphp4 UTSW 4 152,628,863 (GRCm39) missense probably benign 0.07
R6806:Nphp4 UTSW 4 152,622,558 (GRCm39) missense probably benign 0.02
R7006:Nphp4 UTSW 4 152,573,259 (GRCm39) missense probably benign 0.12
R7381:Nphp4 UTSW 4 152,583,460 (GRCm39) missense possibly damaging 0.94
R7411:Nphp4 UTSW 4 152,639,174 (GRCm39) missense probably benign 0.25
R7638:Nphp4 UTSW 4 152,638,991 (GRCm39) missense probably benign 0.08
R7814:Nphp4 UTSW 4 152,628,860 (GRCm39) missense probably damaging 1.00
R7814:Nphp4 UTSW 4 152,608,729 (GRCm39) missense possibly damaging 0.93
R7841:Nphp4 UTSW 4 152,581,140 (GRCm39) missense probably benign 0.01
R8346:Nphp4 UTSW 4 152,645,778 (GRCm39) missense probably damaging 1.00
R8479:Nphp4 UTSW 4 152,608,747 (GRCm39) missense probably benign 0.01
R8847:Nphp4 UTSW 4 152,590,863 (GRCm39) missense probably damaging 1.00
R8995:Nphp4 UTSW 4 152,623,345 (GRCm39) missense probably damaging 1.00
R8997:Nphp4 UTSW 4 152,623,345 (GRCm39) missense probably damaging 1.00
R9075:Nphp4 UTSW 4 152,591,905 (GRCm39) missense probably damaging 1.00
R9089:Nphp4 UTSW 4 152,645,673 (GRCm39) missense possibly damaging 0.87
R9191:Nphp4 UTSW 4 152,640,687 (GRCm39) missense probably damaging 1.00
R9274:Nphp4 UTSW 4 152,640,056 (GRCm39) missense probably benign 0.05
R9311:Nphp4 UTSW 4 152,608,714 (GRCm39) missense probably damaging 0.99
R9383:Nphp4 UTSW 4 152,628,918 (GRCm39) critical splice donor site probably null
R9628:Nphp4 UTSW 4 152,568,966 (GRCm39) missense probably damaging 1.00
R9711:Nphp4 UTSW 4 152,623,434 (GRCm39) missense possibly damaging 0.77
R9712:Nphp4 UTSW 4 152,631,521 (GRCm39) missense probably benign 0.17
R9752:Nphp4 UTSW 4 152,621,737 (GRCm39) missense probably benign 0.00
R9790:Nphp4 UTSW 4 152,646,605 (GRCm39) missense probably null 0.64
R9791:Nphp4 UTSW 4 152,646,605 (GRCm39) missense probably null 0.64
T0970:Nphp4 UTSW 4 152,640,836 (GRCm39) missense probably damaging 1.00
X0058:Nphp4 UTSW 4 152,644,164 (GRCm39) missense possibly damaging 0.95
Z1177:Nphp4 UTSW 4 152,602,653 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGATGCCTACCGGGAAC -3'
(R):5'- TAGAACTGTCCAACGCCCAG -3'

Sequencing Primer
(F):5'- ACGTACCAAGGCCGAGAGC -3'
(R):5'- ACAGTTGGCTGGGTCACATACAC -3'
Posted On 2019-05-15