Mutagenetix > Incidental Mutation

Incidental Mutation 'R7124:Nphp4'

552191

Institutional Source

Beutler Lab

Gene Symbol

Nphp4

Ensembl Gene

ENSMUSG00000039577

Gene Name

nephronophthisis 4 (juvenile) homolog (human)

Synonyms

nmf192, 4930564O18Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.134) question?

Stock #

R7124 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

152476706-152563183 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 152555684 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1009 (D1009G)

Ref Sequence

ENSEMBL: ENSMUSP00000080128 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056567] [ENSMUST00000081393]

AlphaFold

P59240

Predicted Effect

probably benign
Transcript: ENSMUST00000056567
AA Change: D1009G

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000049920
Gene: ENSMUSG00000039577
AA Change: D1009G

Domain	Start	End	E-Value	Type
low complexity region	317	333	N/A	INTRINSIC
low complexity region	367	380	N/A	INTRINSIC
low complexity region	473	484	N/A	INTRINSIC
low complexity region	507	530	N/A	INTRINSIC
low complexity region	896	909	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000081393
AA Change: D1009G

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000080128
Gene: ENSMUSG00000039577
AA Change: D1009G

Domain	Start	End	E-Value	Type
low complexity region	317	333	N/A	INTRINSIC
low complexity region	367	380	N/A	INTRINSIC
low complexity region	473	484	N/A	INTRINSIC
low complexity region	507	530	N/A	INTRINSIC
low complexity region	896	909	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142027

Meta Mutation Damage Score

0.1519

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

97% (72/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in renal tubular development and function. This protein interacts with nephrocystin, and belongs to a multifunctional complex that is localized to actin- and microtubule-based structures. Mutations in this gene are associated with nephronophthisis type 4, a renal disease, and with Senior-Loken syndrome type 4, a combination of nephronophthisis and retinitis pigmentosa. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mutant mice have a mottled retina with photoreceptor degeneration and male infertility associated with oligozoospermia and asthenozoospermia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	C	3: 124,414,393	S212R	probably benign	Het
4930562C15Rik	T	C	16: 4,864,332	S170P	probably benign	Het
9330182O14Rik	G	A	15: 40,144,907	C59Y	unknown	Het
AA986860	A	G	1: 130,742,887	E282G	possibly damaging	Het
Adam1a	G	T	5: 121,519,334	T632K	probably benign	Het
Aspg	G	T	12: 112,122,983	A402S	probably damaging	Het
Capn7	C	T	14: 31,336,685		probably benign	Het
Card9	C	T	2: 26,356,884		probably null	Het
Cdh13	T	C	8: 118,968,173	V254A	probably damaging	Het
Colec10	T	C	15: 54,462,371	V199A	probably damaging	Het
Copb2	T	C	9: 98,577,053	S283P	probably damaging	Het
Csmd1	G	T	8: 15,903,202	S3426R	probably damaging	Het
Cyp4f14	A	G	17: 32,914,588	V98A	probably benign	Het
Disp1	C	A	1: 183,087,466	R1130L	probably damaging	Het
Dysf	A	G	6: 84,190,901		probably null	Het
Eif4ebp1	T	C	8: 27,273,419	V80A	probably damaging	Het
Eloa	T	A	4: 136,009,141	I565F	probably damaging	Het
Espn	G	T	4: 152,131,264	H513N	probably benign	Het
Fam83c	C	T	2: 155,829,571	S648N	probably benign	Het
Fdxr	C	T	11: 115,269,577	V351M	probably benign	Het
Fras1	A	T	5: 96,714,401	D2213V	probably damaging	Het
Gbp4	T	A	5: 105,119,959	I474F	possibly damaging	Het
Gm11639	T	C	11: 104,738,274	F926S	probably benign	Het
Golgb1	T	C	16: 36,913,673	V1135A	probably benign	Het
Gpt2	G	A	8: 85,518,052	E325K	probably benign	Het
Hipk2	A	T	6: 38,818,478	Y285*	probably null	Het
Ifi27l2b	T	C	12: 103,451,320	I203V	probably damaging	Het
Itga10	T	A	3: 96,651,765	M390K	probably damaging	Het
Itgb8	G	T	12: 119,202,424	S124*	probably null	Het
Klhdc10	T	A	6: 30,441,827	F173I	probably damaging	Het
Kng2	T	G	16: 23,012,055	N168T	probably damaging	Het
Krtap24-1	T	C	16: 88,611,546	T231A	probably damaging	Het
Lbx2	A	T	6: 83,088,064	D194V	probably damaging	Het
Lrrc39	C	A	3: 116,565,913	Q36K	probably benign	Het
Madd	T	C	2: 91,162,048	E1093G	possibly damaging	Het
Mfap3l	A	G	8: 60,671,269	T182A	probably damaging	Het
Myo9b	T	A	8: 71,333,701	Y670*	probably null	Het
Nbea	A	G	3: 55,992,444	L1428P	probably damaging	Het
Nkx2-3	T	C	19: 43,614,806	Y284H	possibly damaging	Het
Npy2r	G	A	3: 82,541,183	A95V	probably damaging	Het
Nuggc	A	G	14: 65,608,802	E70G	probably damaging	Het
Olfr1020	T	C	2: 85,849,910	S153P	probably benign	Het
Olfr1028	T	A	2: 85,951,473	S137T	possibly damaging	Het
Palld	A	T	8: 61,516,645	V1215D	unknown	Het
Pard6g	T	C	18: 80,117,125	I151T	possibly damaging	Het
Parp12	T	C	6: 39,111,736	I189V	probably benign	Het
Parp4	A	G	14: 56,602,799	I554V	probably benign	Het
Pcnx2	G	A	8: 125,753,617	P1984S	probably damaging	Het
Piwil4	T	C	9: 14,736,900	M128V	probably benign	Het
Polr2a	C	A	11: 69,737,462	E1302*	probably null	Het
Psg17	C	A	7: 18,814,496	G450V	probably damaging	Het
Psg17	C	G	7: 18,814,497	G450R	probably damaging	Het
Rag1	T	C	2: 101,643,783	E338G	probably damaging	Het
Rev3l	A	T	10: 39,822,167	K887*	probably null	Het
Rragd	T	C	4: 32,996,027	F124S	possibly damaging	Het
Scube1	A	T	15: 83,629,511		probably null	Het
Sfpq	A	T	4: 127,025,932	D490V	possibly damaging	Het
Smc1b	G	T	15: 85,071,597	Q1034K	probably damaging	Het
Smg7	T	C	1: 152,878,080	N5S	probably benign	Het
Spata31d1a	A	C	13: 59,702,487	L609R	probably damaging	Het
Ssh2	A	G	11: 77,454,338	K1050E	probably benign	Het
Stab1	G	A	14: 31,160,867	T393I	possibly damaging	Het
Sult2a4	C	T	7: 13,988,395	W49*	probably null	Het
Thrap3	A	T	4: 126,180,438	S172T	unknown	Het
Tmem130	A	G	5: 144,750,911	V205A	probably damaging	Het
Ube2d2b	A	G	5: 107,830,851	I123V	probably benign	Het
Unc79	G	T	12: 103,061,393	L414F	probably damaging	Het
Vmn2r30	C	T	7: 7,334,184	S151N	probably benign	Het
Vmn2r54	T	A	7: 12,622,151	T443S	probably benign	Het
Zfp229	T	A	17: 21,742,616	S51T	probably damaging	Het
Zfp617	T	C	8: 71,932,540	L238P	probably damaging	Het
Zfp707	T	A	15: 75,973,549	C87*	probably null	Het
Zfp853	T	C	5: 143,289,607	K101R	unknown	Het

Other mutations in Nphp4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00922:Nphp4	APN	4	152537309	splice site	probably benign
IGL00963:Nphp4	APN	4	152537861	missense	probably benign	0.01
IGL01571:Nphp4	APN	4	152556382	missense	probably benign	0.21
IGL01707:Nphp4	APN	4	152538983	missense	probably benign	0.00
IGL01837:Nphp4	APN	4	152488881	missense	probably damaging	0.96
IGL02341:Nphp4	APN	4	152555469	splice site	probably benign
IGL02558:Nphp4	APN	4	152555531	missense	probably damaging	1.00
IGL02563:Nphp4	APN	4	152556220	missense	probably benign	0.00
IGL02712:Nphp4	APN	4	152556275	missense	probably damaging	1.00
IGL03023:Nphp4	APN	4	152524235	splice site	probably null
R0280:Nphp4	UTSW	4	152551936	splice site	probably benign
R0317:Nphp4	UTSW	4	152551931	critical splice donor site	probably null
R0410:Nphp4	UTSW	4	152557046	missense	probably benign
R0433:Nphp4	UTSW	4	152518172	missense	probably benign	0.00
R0706:Nphp4	UTSW	4	152555617	missense	probably damaging	0.98
R0785:Nphp4	UTSW	4	152562109	missense	possibly damaging	0.58
R0890:Nphp4	UTSW	4	152498220	missense	possibly damaging	0.93
R0930:Nphp4	UTSW	4	152538055	missense	probably benign	0.01
R1202:Nphp4	UTSW	4	152488729	splice site	probably null
R1203:Nphp4	UTSW	4	152488832	missense	probably damaging	0.96
R1366:Nphp4	UTSW	4	152502926	missense	probably damaging	0.96
R1452:Nphp4	UTSW	4	152547018	missense	probably damaging	0.99
R1598:Nphp4	UTSW	4	152562090	missense	probably benign	0.00
R1699:Nphp4	UTSW	4	152496664	missense	probably damaging	0.99
R2007:Nphp4	UTSW	4	152554654	missense	probably damaging	0.97
R2082:Nphp4	UTSW	4	152559364	missense	probably benign	0.38
R2264:Nphp4	UTSW	4	152503008	splice site	probably benign
R2280:Nphp4	UTSW	4	152557043	missense	possibly damaging	0.95
R2281:Nphp4	UTSW	4	152557043	missense	possibly damaging	0.95
R2926:Nphp4	UTSW	4	152518139	missense	probably damaging	0.99
R3764:Nphp4	UTSW	4	152538017	splice site	probably benign
R4084:Nphp4	UTSW	4	152488791	missense	probably damaging	1.00
R4091:Nphp4	UTSW	4	152547018	missense	probably damaging	0.97
R4240:Nphp4	UTSW	4	152555684	missense	probably benign	0.07
R4701:Nphp4	UTSW	4	152496659	missense	probably damaging	1.00
R4778:Nphp4	UTSW	4	152556291	missense	probably benign	0.44
R4783:Nphp4	UTSW	4	152554546	missense	probably benign	0.00
R4784:Nphp4	UTSW	4	152554546	missense	probably benign	0.00
R4974:Nphp4	UTSW	4	152537793	missense	probably damaging	1.00
R5053:Nphp4	UTSW	4	152544462	splice site	probably null
R5117:Nphp4	UTSW	4	152524232	splice site	probably null
R5128:Nphp4	UTSW	4	152502991	missense	probably benign	0.01
R5665:Nphp4	UTSW	4	152506485	missense	probably benign	0.25
R5890:Nphp4	UTSW	4	152547079	missense	probably benign	0.44
R6171:Nphp4	UTSW	4	152544449	missense	probably damaging	0.99
R6601:Nphp4	UTSW	4	152503007	splice site	probably null
R6772:Nphp4	UTSW	4	152544406	missense	probably benign	0.07
R6806:Nphp4	UTSW	4	152538101	missense	probably benign	0.02
R7006:Nphp4	UTSW	4	152488802	missense	probably benign	0.12
R7381:Nphp4	UTSW	4	152499003	missense	possibly damaging	0.94
R7411:Nphp4	UTSW	4	152554717	missense	probably benign	0.25
R7638:Nphp4	UTSW	4	152554534	missense	probably benign	0.08
R7814:Nphp4	UTSW	4	152524272	missense	possibly damaging	0.93
R7814:Nphp4	UTSW	4	152544403	missense	probably damaging	1.00
R7841:Nphp4	UTSW	4	152496683	missense	probably benign	0.01
R8346:Nphp4	UTSW	4	152561321	missense	probably damaging	1.00
R8479:Nphp4	UTSW	4	152524290	missense	probably benign	0.01
R8847:Nphp4	UTSW	4	152506406	missense	probably damaging	1.00
R8995:Nphp4	UTSW	4	152538888	missense	probably damaging	1.00
R8997:Nphp4	UTSW	4	152538888	missense	probably damaging	1.00
R9075:Nphp4	UTSW	4	152507448	missense	probably damaging	1.00
R9089:Nphp4	UTSW	4	152561216	missense	possibly damaging	0.87
R9191:Nphp4	UTSW	4	152556230	missense	probably damaging	1.00
R9274:Nphp4	UTSW	4	152555599	missense	probably benign	0.05
R9311:Nphp4	UTSW	4	152524257	missense	probably damaging	0.99
R9383:Nphp4	UTSW	4	152544461	critical splice donor site	probably null
R9628:Nphp4	UTSW	4	152484509	missense	probably damaging	1.00
R9711:Nphp4	UTSW	4	152538977	missense	possibly damaging	0.77
R9712:Nphp4	UTSW	4	152547064	missense	probably benign	0.17
R9752:Nphp4	UTSW	4	152537280	missense	probably benign	0.00
R9790:Nphp4	UTSW	4	152562148	missense	probably null	0.64
R9791:Nphp4	UTSW	4	152562148	missense	probably null	0.64
T0970:Nphp4	UTSW	4	152556379	missense	probably damaging	1.00
X0058:Nphp4	UTSW	4	152559707	missense	possibly damaging	0.95
Z1177:Nphp4	UTSW	4	152518196	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTGATGCCTACCGGGAAC -3'
(R):5'- TAGAACTGTCCAACGCCCAG -3'

Sequencing Primer
(F):5'- ACGTACCAAGGCCGAGAGC -3'
(R):5'- ACAGTTGGCTGGGTCACATACAC -3'

Posted On

2019-05-15