Incidental Mutation 'R7124:Adam1a'
ID552195
Institutional Source Beutler Lab
Gene Symbol Adam1a
Ensembl Gene ENSMUSG00000072647
Gene Namea disintegrin and metallopeptidase domain 1a
Synonymsfertilin alpha, Ftna, PH-30 alpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R7124 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location121518576-121545482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 121519334 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 632 (T632K)
Ref Sequence ENSEMBL: ENSMUSP00000098320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100757] [ENSMUST00000111795] [ENSMUST00000125946] [ENSMUST00000156080] [ENSMUST00000200170]
Predicted Effect probably benign
Transcript: ENSMUST00000100757
AA Change: T632K

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000098320
Gene: ENSMUSG00000072647
AA Change: T632K

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 70 191 1.5e-18 PFAM
Pfam:Reprolysin_5 233 410 2.8e-15 PFAM
Pfam:Reprolysin_4 234 421 6.3e-9 PFAM
Pfam:Reprolysin 235 429 1.3e-70 PFAM
Pfam:Reprolysin_3 255 381 3.8e-14 PFAM
Pfam:Reprolysin_2 255 419 5.6e-9 PFAM
DISIN 447 520 6.45e-37 SMART
ACR 521 660 4.59e-62 SMART
EGF 666 697 1.99e1 SMART
transmembrane domain 741 763 N/A INTRINSIC
low complexity region 764 791 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111795
SMART Domains Protein: ENSMUSP00000144614
Gene: ENSMUSG00000029452

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125946
SMART Domains Protein: ENSMUSP00000142503
Gene: ENSMUSG00000105340

DomainStartEndE-ValueType
S_TKc 22 304 5.3e-84 SMART
coiled coil region 407 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156080
SMART Domains Protein: ENSMUSP00000121579
Gene: ENSMUSG00000029452

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
transmembrane domain 94 116 N/A INTRINSIC
transmembrane domain 140 162 N/A INTRINSIC
transmembrane domain 205 227 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200170
SMART Domains Protein: ENSMUSP00000143668
Gene: ENSMUSG00000072647

DomainStartEndE-ValueType
S_TKc 22 304 8.22e-84 SMART
coiled coil region 407 432 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 97% (72/74)
MGI Phenotype PHENOTYPE: Homozygous null mice display male infertility with asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A C 3: 124,414,393 S212R probably benign Het
4930562C15Rik T C 16: 4,864,332 S170P probably benign Het
9330182O14Rik G A 15: 40,144,907 C59Y unknown Het
AA986860 A G 1: 130,742,887 E282G possibly damaging Het
Aspg G T 12: 112,122,983 A402S probably damaging Het
Capn7 C T 14: 31,336,685 probably benign Het
Card9 C T 2: 26,356,884 probably null Het
Cdh13 T C 8: 118,968,173 V254A probably damaging Het
Colec10 T C 15: 54,462,371 V199A probably damaging Het
Copb2 T C 9: 98,577,053 S283P probably damaging Het
Csmd1 G T 8: 15,903,202 S3426R probably damaging Het
Cyp4f14 A G 17: 32,914,588 V98A probably benign Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dysf A G 6: 84,190,901 probably null Het
Eif4ebp1 T C 8: 27,273,419 V80A probably damaging Het
Eloa T A 4: 136,009,141 I565F probably damaging Het
Espn G T 4: 152,131,264 H513N probably benign Het
Fam83c C T 2: 155,829,571 S648N probably benign Het
Fdxr C T 11: 115,269,577 V351M probably benign Het
Fras1 A T 5: 96,714,401 D2213V probably damaging Het
Gbp4 T A 5: 105,119,959 I474F possibly damaging Het
Gm11639 T C 11: 104,738,274 F926S probably benign Het
Golgb1 T C 16: 36,913,673 V1135A probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Hipk2 A T 6: 38,818,478 Y285* probably null Het
Ifi27l2b T C 12: 103,451,320 I203V probably damaging Het
Itga10 T A 3: 96,651,765 M390K probably damaging Het
Itgb8 G T 12: 119,202,424 S124* probably null Het
Klhdc10 T A 6: 30,441,827 F173I probably damaging Het
Kng2 T G 16: 23,012,055 N168T probably damaging Het
Krtap24-1 T C 16: 88,611,546 T231A probably damaging Het
Lbx2 A T 6: 83,088,064 D194V probably damaging Het
Lrrc39 C A 3: 116,565,913 Q36K probably benign Het
Madd T C 2: 91,162,048 E1093G possibly damaging Het
Mfap3l A G 8: 60,671,269 T182A probably damaging Het
Myo9b T A 8: 71,333,701 Y670* probably null Het
Nbea A G 3: 55,992,444 L1428P probably damaging Het
Nkx2-3 T C 19: 43,614,806 Y284H possibly damaging Het
Nphp4 A G 4: 152,555,684 D1009G probably benign Het
Npy2r G A 3: 82,541,183 A95V probably damaging Het
Nuggc A G 14: 65,608,802 E70G probably damaging Het
Olfr1020 T C 2: 85,849,910 S153P probably benign Het
Olfr1028 T A 2: 85,951,473 S137T possibly damaging Het
Palld A T 8: 61,516,645 V1215D unknown Het
Pard6g T C 18: 80,117,125 I151T possibly damaging Het
Parp12 T C 6: 39,111,736 I189V probably benign Het
Parp4 A G 14: 56,602,799 I554V probably benign Het
Pcnx2 G A 8: 125,753,617 P1984S probably damaging Het
Piwil4 T C 9: 14,736,900 M128V probably benign Het
Polr2a C A 11: 69,737,462 E1302* probably null Het
Psg17 C A 7: 18,814,496 G450V probably damaging Het
Psg17 C G 7: 18,814,497 G450R probably damaging Het
Rag1 T C 2: 101,643,783 E338G probably damaging Het
Rev3l A T 10: 39,822,167 K887* probably null Het
Rragd T C 4: 32,996,027 F124S possibly damaging Het
Scube1 A T 15: 83,629,511 probably null Het
Sfpq A T 4: 127,025,932 D490V possibly damaging Het
Smc1b G T 15: 85,071,597 Q1034K probably damaging Het
Smg7 T C 1: 152,878,080 N5S probably benign Het
Spata31d1a A C 13: 59,702,487 L609R probably damaging Het
Ssh2 A G 11: 77,454,338 K1050E probably benign Het
Stab1 G A 14: 31,160,867 T393I possibly damaging Het
Sult2a4 C T 7: 13,988,395 W49* probably null Het
Thrap3 A T 4: 126,180,438 S172T unknown Het
Tmem130 A G 5: 144,750,911 V205A probably damaging Het
Ube2d2b A G 5: 107,830,851 I123V probably benign Het
Unc79 G T 12: 103,061,393 L414F probably damaging Het
Vmn2r30 C T 7: 7,334,184 S151N probably benign Het
Vmn2r54 T A 7: 12,622,151 T443S probably benign Het
Zfp229 T A 17: 21,742,616 S51T probably damaging Het
Zfp617 T C 8: 71,932,540 L238P probably damaging Het
Zfp707 T A 15: 75,973,549 C87* probably null Het
Zfp853 T C 5: 143,289,607 K101R unknown Het
Other mutations in Adam1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01451:Adam1a APN 5 121519376 missense probably benign 0.09
IGL01467:Adam1a APN 5 121519728 missense probably damaging 1.00
IGL02158:Adam1a APN 5 121518971 nonsense probably null
R1468:Adam1a UTSW 5 121519776 splice site probably null
R1468:Adam1a UTSW 5 121519776 splice site probably null
R1593:Adam1a UTSW 5 121519643 missense probably benign 0.02
R1848:Adam1a UTSW 5 121519620 missense probably damaging 1.00
R1925:Adam1a UTSW 5 121519450 nonsense probably null
R2176:Adam1a UTSW 5 121519586 missense probably benign 0.01
R2232:Adam1a UTSW 5 121519732 missense possibly damaging 0.93
R3692:Adam1a UTSW 5 121519322 missense probably damaging 1.00
R4732:Adam1a UTSW 5 121519434 missense probably benign 0.34
R4733:Adam1a UTSW 5 121519434 missense probably benign 0.34
R4835:Adam1a UTSW 5 121519689 missense probably damaging 1.00
R5199:Adam1a UTSW 5 121521152 missense probably benign 0.23
R6026:Adam1a UTSW 5 121519362 missense probably damaging 1.00
R6936:Adam1a UTSW 5 121519362 missense probably damaging 1.00
R7016:Adam1a UTSW 5 121521038 missense probably benign 0.01
R7294:Adam1a UTSW 5 121520005 nonsense probably null
R7501:Adam1a UTSW 5 121518948 missense possibly damaging 0.85
R7641:Adam1a UTSW 5 121519307 missense probably benign 0.00
R8548:Adam1a UTSW 5 121520102 missense probably damaging 1.00
R8917:Adam1a UTSW 5 121519082 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- CATCGCAGTGACAGTGCTTG -3'
(R):5'- CCCTGAGGAATGTTACATTTCAG -3'

Sequencing Primer
(F):5'- CAGTGCTTGAAATTGTTGCACACTC -3'
(R):5'- TTGGAAACTGTGGCCATCC -3'
Posted On2019-05-15