Incidental Mutation 'R0599:Olfr639'
ID 55220
Institutional Source Beutler Lab
Gene Symbol Olfr639
Ensembl Gene ENSMUSG00000066263
Gene Name olfactory receptor 639
Synonyms MOR12-1, GA_x6K02T2PBJ9-6747143-6746193
MMRRC Submission 038788-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock # R0599 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 104006231-104017303 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 104012188 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 171 (C171*)
Ref Sequence ENSEMBL: ENSMUSP00000149743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106862] [ENSMUST00000138055] [ENSMUST00000215653]
AlphaFold Q8VGY8
Predicted Effect probably null
Transcript: ENSMUST00000106862
AA Change: C171*
SMART Domains Protein: ENSMUSP00000102475
Gene: ENSMUSG00000066263
AA Change: C171*

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 1.4e-120 PFAM
Pfam:7TM_GPCR_Srsx 37 173 3.6e-9 PFAM
Pfam:7tm_1 43 294 4.9e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000215653
AA Change: C171*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,552,245 L978P probably damaging Het
Abcb1a C T 5: 8,698,539 T290M probably benign Het
Abcd3 A T 3: 121,765,093 F585I probably damaging Het
Acan A G 7: 79,111,290 probably benign Het
Anxa6 T C 11: 54,979,466 D667G possibly damaging Het
Ap3m2 G T 8: 22,793,112 A208D possibly damaging Het
Arhgap17 A T 7: 123,303,790 probably benign Het
Bptf A G 11: 107,068,382 V1838A probably damaging Het
Brip1 T A 11: 86,152,737 M334L probably benign Het
Btbd10 C T 7: 113,335,309 probably benign Het
Btbd11 G A 10: 85,658,336 G1106D probably damaging Het
Cdh7 C A 1: 110,052,966 T208K probably damaging Het
Cnga4 A G 7: 105,405,818 Y100C probably damaging Het
Dnah10 G A 5: 124,800,953 V2644M probably damaging Het
Dnah9 T C 11: 65,965,689 D2882G probably damaging Het
Eapp T A 12: 54,685,962 K117M probably damaging Het
Eml3 T C 19: 8,939,063 V673A probably benign Het
Ephb4 G A 5: 137,369,855 C754Y probably damaging Het
Eps8l1 A G 7: 4,477,957 D33G possibly damaging Het
Farsa A G 8: 84,867,583 K321E probably damaging Het
Fry G A 5: 150,437,159 R2090Q probably damaging Het
Gm10283 A G 8: 60,501,224 probably benign Het
Grm4 A G 17: 27,431,490 I844T probably benign Het
Gtf2h3 A G 5: 124,588,628 D124G probably benign Het
Gulo A T 14: 65,990,441 D347E probably damaging Het
Hmcn1 A G 1: 150,609,801 F4350S possibly damaging Het
Hspg2 A G 4: 137,512,401 D473G probably damaging Het
Il17ra T A 6: 120,481,505 I539N probably damaging Het
Insrr A G 3: 87,813,133 E1026G probably damaging Het
Itga2 A T 13: 114,856,650 probably benign Het
Kdm1b A T 13: 47,058,810 D190V possibly damaging Het
Lima1 A T 15: 99,802,159 N146K probably damaging Het
Mettl7a3 A T 15: 100,335,383 N152Y possibly damaging Het
Mnt G T 11: 74,842,296 V85L probably benign Het
Mon2 T A 10: 123,026,065 probably benign Het
Mtf1 T C 4: 124,820,201 probably benign Het
Mylk4 T C 13: 32,712,754 probably null Het
Myo18b A C 5: 112,865,750 L780R probably damaging Het
Myo1e A G 9: 70,376,660 probably benign Het
Obscn A G 11: 59,073,696 S705P probably damaging Het
Ocrl A T X: 47,936,086 probably benign Het
Olfr1260 T C 2: 89,978,201 F141S probably benign Het
Olfr394 A T 11: 73,887,904 M156K probably benign Het
Olfr599 A G 7: 103,338,186 N44S probably damaging Het
Otof T A 5: 30,370,705 K1931N probably damaging Het
Plcxd3 A G 15: 4,516,867 S118G probably damaging Het
Plcz1 T A 6: 140,028,542 Q58L probably benign Het
Proser1 C A 3: 53,479,064 P789Q probably benign Het
Rassf4 T C 6: 116,645,936 E38G probably damaging Het
Ros1 A T 10: 52,123,300 Y1164N probably damaging Het
Rpgrip1l A G 8: 91,305,000 I83T probably damaging Het
Scn9a T G 2: 66,526,799 K1053Q probably damaging Het
Sgsm1 G T 5: 113,245,028 Q1087K probably damaging Het
Slc16a10 T C 10: 40,141,918 D40G probably benign Het
Slc27a6 A G 18: 58,556,813 D117G probably damaging Het
Slc2a9 T A 5: 38,480,144 probably benign Het
Slc4a1 A G 11: 102,357,915 probably benign Het
Smarca1 T A X: 47,823,426 Q982L probably benign Het
Sp100 T A 1: 85,681,110 I320N possibly damaging Het
Stx8 A T 11: 68,109,362 R209S probably null Het
Sulf2 T C 2: 166,083,879 T453A possibly damaging Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tenm2 T A 11: 36,024,780 I1976F possibly damaging Het
Tenm3 G A 8: 48,277,710 S1341L probably damaging Het
Tmem130 C T 5: 144,737,809 V369M probably damaging Het
Tmem200c A G 17: 68,840,511 K30E probably damaging Het
Tmem225 A G 9: 40,149,747 I117V possibly damaging Het
Top2a A G 11: 99,001,417 I1073T probably damaging Het
Trps1 A C 15: 50,831,860 Y296* probably null Het
Tubg1 T C 11: 101,125,336 M377T probably benign Het
Vmn1r35 G A 6: 66,679,513 H58Y probably benign Het
Vmn1r56 G A 7: 5,196,430 H63Y probably benign Het
Vmn1r75 T C 7: 11,881,262 probably null Het
Vnn3 T C 10: 23,865,705 S303P possibly damaging Het
Wdr49 C T 3: 75,431,076 probably null Het
Wdr49 T C 3: 75,449,890 probably null Het
Zcchc6 A G 13: 59,809,487 V7A probably damaging Het
Zzef1 T C 11: 72,913,178 L2582P probably damaging Het
Other mutations in Olfr639
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Olfr639 APN 7 104012114 missense probably damaging 1.00
IGL01547:Olfr639 APN 7 104012660 missense probably benign 0.43
IGL02173:Olfr639 APN 7 104011830 missense probably damaging 1.00
IGL02707:Olfr639 APN 7 104012402 missense probably damaging 1.00
IGL03124:Olfr639 APN 7 104011794 missense probably benign
R0004:Olfr639 UTSW 7 104012431 missense probably benign 0.02
R0086:Olfr639 UTSW 7 104012054 missense probably benign 0.23
R0370:Olfr639 UTSW 7 104012059 missense probably damaging 0.99
R1351:Olfr639 UTSW 7 104012316 missense possibly damaging 0.81
R1604:Olfr639 UTSW 7 104011955 missense probably damaging 1.00
R2314:Olfr639 UTSW 7 104012229 missense probably benign 0.09
R2656:Olfr639 UTSW 7 104011865 missense probably damaging 0.96
R4594:Olfr639 UTSW 7 104012417 missense probably benign 0.01
R4774:Olfr639 UTSW 7 104012588 missense probably benign 0.00
R4945:Olfr639 UTSW 7 104012378 missense possibly damaging 0.85
R4968:Olfr639 UTSW 7 104012570 missense probably damaging 1.00
R4981:Olfr639 UTSW 7 104012105 missense probably damaging 0.97
R5072:Olfr639 UTSW 7 104012118 missense probably damaging 0.97
R5982:Olfr639 UTSW 7 104011910 missense probably damaging 1.00
R6303:Olfr639 UTSW 7 104012031 missense probably damaging 1.00
R6304:Olfr639 UTSW 7 104012031 missense probably damaging 1.00
R6332:Olfr639 UTSW 7 104011773 missense probably benign 0.00
R7107:Olfr639 UTSW 7 104012282 missense probably benign 0.16
R7152:Olfr639 UTSW 7 104012019 missense probably benign
R7456:Olfr639 UTSW 7 104011838 missense possibly damaging 0.83
R7849:Olfr639 UTSW 7 104012303 missense possibly damaging 0.56
R8023:Olfr639 UTSW 7 104011799 missense probably damaging 0.97
R8082:Olfr639 UTSW 7 104012690 missense probably benign 0.04
R8215:Olfr639 UTSW 7 104012123 missense possibly damaging 0.85
R8428:Olfr639 UTSW 7 104012425 nonsense probably null
R8985:Olfr639 UTSW 7 104012160 missense probably damaging 1.00
R9261:Olfr639 UTSW 7 104012129 missense probably damaging 1.00
Z1177:Olfr639 UTSW 7 104012150 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCGACATAAGTGTGTGGACCACTG -3'
(R):5'- TGGCTGTTTGGCACAAATGTTCTTC -3'

Sequencing Primer
(F):5'- CATGCTTGGCAACACGATG -3'
(R):5'- GGCACAAATGTTCTTCATTCACAC -3'
Posted On 2013-07-11