Mutagenetix > Incidental Mutation

Incidental Mutation 'R7124:Pcnx2'

552215

Institutional Source

Beutler Lab

Gene Symbol

Pcnx2

Ensembl Gene

ENSMUSG00000060212

Gene Name

pecanex homolog 2

Synonyms

Pcnxl2, E330039K12Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7124 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

125751508-125898317 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 125753617 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 1984 (P1984S)

Ref Sequence

ENSEMBL: ENSMUSP00000042294 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047239]

AlphaFold

Q5DU28

Predicted Effect

probably damaging
Transcript: ENSMUST00000047239
AA Change: P1984S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000042294
Gene: ENSMUSG00000060212
AA Change: P1984S

Domain	Start	End	E-Value	Type
transmembrane domain	36	53	N/A	INTRINSIC
transmembrane domain	60	82	N/A	INTRINSIC
low complexity region	94	104	N/A	INTRINSIC
low complexity region	391	415	N/A	INTRINSIC
low complexity region	457	476	N/A	INTRINSIC
low complexity region	727	742	N/A	INTRINSIC
low complexity region	806	817	N/A	INTRINSIC
transmembrane domain	823	842	N/A	INTRINSIC
transmembrane domain	849	866	N/A	INTRINSIC
transmembrane domain	881	902	N/A	INTRINSIC
transmembrane domain	934	956	N/A	INTRINSIC
transmembrane domain	976	998	N/A	INTRINSIC
transmembrane domain	1011	1030	N/A	INTRINSIC
transmembrane domain	1080	1102	N/A	INTRINSIC
transmembrane domain	1104	1126	N/A	INTRINSIC
Pfam:Pecanex_C	1603	1828	3.5e-113	PFAM
low complexity region	1864	1889	N/A	INTRINSIC
low complexity region	1968	1981	N/A	INTRINSIC
low complexity region	2004	2019	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

97% (72/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene contains coding mononucleotide repeats that are associated with tumors of high mcrosatellite instability (MSI-H). Defects in this gene are involved in the tumorigenesis of MSI-H colorectal carcinomas. [provided by RefSeq, Jun 2016]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	C	3: 124,414,393	S212R	probably benign	Het
4930562C15Rik	T	C	16: 4,864,332	S170P	probably benign	Het
9330182O14Rik	G	A	15: 40,144,907	C59Y	unknown	Het
AA986860	A	G	1: 130,742,887	E282G	possibly damaging	Het
Adam1a	G	T	5: 121,519,334	T632K	probably benign	Het
Aspg	G	T	12: 112,122,983	A402S	probably damaging	Het
Capn7	C	T	14: 31,336,685		probably benign	Het
Card9	C	T	2: 26,356,884		probably null	Het
Cdh13	T	C	8: 118,968,173	V254A	probably damaging	Het
Colec10	T	C	15: 54,462,371	V199A	probably damaging	Het
Copb2	T	C	9: 98,577,053	S283P	probably damaging	Het
Csmd1	G	T	8: 15,903,202	S3426R	probably damaging	Het
Cyp4f14	A	G	17: 32,914,588	V98A	probably benign	Het
Disp1	C	A	1: 183,087,466	R1130L	probably damaging	Het
Dysf	A	G	6: 84,190,901		probably null	Het
Eif4ebp1	T	C	8: 27,273,419	V80A	probably damaging	Het
Eloa	T	A	4: 136,009,141	I565F	probably damaging	Het
Espn	G	T	4: 152,131,264	H513N	probably benign	Het
Fam83c	C	T	2: 155,829,571	S648N	probably benign	Het
Fdxr	C	T	11: 115,269,577	V351M	probably benign	Het
Fras1	A	T	5: 96,714,401	D2213V	probably damaging	Het
Gbp4	T	A	5: 105,119,959	I474F	possibly damaging	Het
Gm11639	T	C	11: 104,738,274	F926S	probably benign	Het
Golgb1	T	C	16: 36,913,673	V1135A	probably benign	Het
Gpt2	G	A	8: 85,518,052	E325K	probably benign	Het
Hipk2	A	T	6: 38,818,478	Y285*	probably null	Het
Ifi27l2b	T	C	12: 103,451,320	I203V	probably damaging	Het
Itga10	T	A	3: 96,651,765	M390K	probably damaging	Het
Itgb8	G	T	12: 119,202,424	S124*	probably null	Het
Klhdc10	T	A	6: 30,441,827	F173I	probably damaging	Het
Kng2	T	G	16: 23,012,055	N168T	probably damaging	Het
Krtap24-1	T	C	16: 88,611,546	T231A	probably damaging	Het
Lbx2	A	T	6: 83,088,064	D194V	probably damaging	Het
Lrrc39	C	A	3: 116,565,913	Q36K	probably benign	Het
Madd	T	C	2: 91,162,048	E1093G	possibly damaging	Het
Mfap3l	A	G	8: 60,671,269	T182A	probably damaging	Het
Myo9b	T	A	8: 71,333,701	Y670*	probably null	Het
Nbea	A	G	3: 55,992,444	L1428P	probably damaging	Het
Nkx2-3	T	C	19: 43,614,806	Y284H	possibly damaging	Het
Nphp4	A	G	4: 152,555,684	D1009G	probably benign	Het
Npy2r	G	A	3: 82,541,183	A95V	probably damaging	Het
Nuggc	A	G	14: 65,608,802	E70G	probably damaging	Het
Olfr1020	T	C	2: 85,849,910	S153P	probably benign	Het
Olfr1028	T	A	2: 85,951,473	S137T	possibly damaging	Het
Palld	A	T	8: 61,516,645	V1215D	unknown	Het
Pard6g	T	C	18: 80,117,125	I151T	possibly damaging	Het
Parp12	T	C	6: 39,111,736	I189V	probably benign	Het
Parp4	A	G	14: 56,602,799	I554V	probably benign	Het
Piwil4	T	C	9: 14,736,900	M128V	probably benign	Het
Polr2a	C	A	11: 69,737,462	E1302*	probably null	Het
Psg17	C	A	7: 18,814,496	G450V	probably damaging	Het
Psg17	C	G	7: 18,814,497	G450R	probably damaging	Het
Rag1	T	C	2: 101,643,783	E338G	probably damaging	Het
Rev3l	A	T	10: 39,822,167	K887*	probably null	Het
Rragd	T	C	4: 32,996,027	F124S	possibly damaging	Het
Scube1	A	T	15: 83,629,511		probably null	Het
Sfpq	A	T	4: 127,025,932	D490V	possibly damaging	Het
Smc1b	G	T	15: 85,071,597	Q1034K	probably damaging	Het
Smg7	T	C	1: 152,878,080	N5S	probably benign	Het
Spata31d1a	A	C	13: 59,702,487	L609R	probably damaging	Het
Ssh2	A	G	11: 77,454,338	K1050E	probably benign	Het
Stab1	G	A	14: 31,160,867	T393I	possibly damaging	Het
Sult2a4	C	T	7: 13,988,395	W49*	probably null	Het
Thrap3	A	T	4: 126,180,438	S172T	unknown	Het
Tmem130	A	G	5: 144,750,911	V205A	probably damaging	Het
Ube2d2b	A	G	5: 107,830,851	I123V	probably benign	Het
Unc79	G	T	12: 103,061,393	L414F	probably damaging	Het
Vmn2r30	C	T	7: 7,334,184	S151N	probably benign	Het
Vmn2r54	T	A	7: 12,622,151	T443S	probably benign	Het
Zfp229	T	A	17: 21,742,616	S51T	probably damaging	Het
Zfp617	T	C	8: 71,932,540	L238P	probably damaging	Het
Zfp707	T	A	15: 75,973,549	C87*	probably null	Het
Zfp853	T	C	5: 143,289,607	K101R	unknown	Het

Other mutations in Pcnx2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00898:Pcnx2	APN	8	125887585	missense	probably damaging	1.00
IGL00900:Pcnx2	APN	8	125863236	splice site	probably benign
IGL01134:Pcnx2	APN	8	125863150	missense	probably benign
IGL01370:Pcnx2	APN	8	125801483	missense	probably damaging	0.96
IGL01452:Pcnx2	APN	8	125838032	missense	probably damaging	1.00
IGL01477:Pcnx2	APN	8	125785305	missense	probably damaging	1.00
IGL01610:Pcnx2	APN	8	125839633	missense	possibly damaging	0.67
IGL01640:Pcnx2	APN	8	125801558	missense	probably benign	0.14
IGL01645:Pcnx2	APN	8	125887917	missense	probably damaging	1.00
IGL01876:Pcnx2	APN	8	125866031	missense	probably benign	0.31
IGL01933:Pcnx2	APN	8	125761654	missense	probably damaging	1.00
IGL02208:Pcnx2	APN	8	125752155	missense	probably benign	0.30
IGL02573:Pcnx2	APN	8	125855273	missense	probably benign	0.34
IGL02810:Pcnx2	APN	8	125887203	missense	probably benign	0.03
IGL02859:Pcnx2	APN	8	125863173	missense	probably damaging	1.00
IGL02879:Pcnx2	APN	8	125772057	missense	probably damaging	1.00
IGL03202:Pcnx2	APN	8	125772044	missense	probably damaging	0.98
IGL03259:Pcnx2	APN	8	125753649	missense	probably benign	0.19
IGL03395:Pcnx2	APN	8	125887523	missense	probably benign	0.00
IGL03410:Pcnx2	APN	8	125887040	missense	probably damaging	1.00
gallen	UTSW	8	125891120	missense	probably damaging	1.00
hotzone	UTSW	8	125891141	missense	probably benign	0.00
R0107:Pcnx2	UTSW	8	125753586	missense	probably benign	0.29
R0477:Pcnx2	UTSW	8	125761567	missense	probably damaging	0.99
R0610:Pcnx2	UTSW	8	125839687	missense	probably damaging	1.00
R0645:Pcnx2	UTSW	8	125760720	missense	possibly damaging	0.64
R0894:Pcnx2	UTSW	8	125886926	splice site	probably benign
R1083:Pcnx2	UTSW	8	125772104	missense	probably damaging	1.00
R1199:Pcnx2	UTSW	8	125887314	missense	possibly damaging	0.60
R1296:Pcnx2	UTSW	8	125773833	missense	probably damaging	1.00
R1445:Pcnx2	UTSW	8	125752284	missense	probably damaging	0.99
R1467:Pcnx2	UTSW	8	125753550	missense	possibly damaging	0.77
R1467:Pcnx2	UTSW	8	125753550	missense	possibly damaging	0.77
R1524:Pcnx2	UTSW	8	125891141	missense	probably benign	0.00
R1537:Pcnx2	UTSW	8	125877449	missense	possibly damaging	0.94
R1574:Pcnx2	UTSW	8	125773930	missense	probably damaging	1.00
R1574:Pcnx2	UTSW	8	125773930	missense	probably damaging	1.00
R1593:Pcnx2	UTSW	8	125759273	missense	probably benign	0.11
R1598:Pcnx2	UTSW	8	125772086	missense	probably benign	0.03
R1603:Pcnx2	UTSW	8	125839626	missense	probably damaging	1.00
R1697:Pcnx2	UTSW	8	125850348	missense	probably damaging	1.00
R1759:Pcnx2	UTSW	8	125773978	missense	probably damaging	1.00
R1855:Pcnx2	UTSW	8	125807996	splice site	probably benign
R1863:Pcnx2	UTSW	8	125818786	missense	probably damaging	0.98
R1930:Pcnx2	UTSW	8	125887714	missense	probably benign	0.10
R1967:Pcnx2	UTSW	8	125815683	missense	possibly damaging	0.51
R1974:Pcnx2	UTSW	8	125887371	missense	probably benign	0.00
R1998:Pcnx2	UTSW	8	125887143	missense	probably damaging	1.00
R2034:Pcnx2	UTSW	8	125818667	critical splice donor site	probably null
R2072:Pcnx2	UTSW	8	125761742	missense	possibly damaging	0.90
R2096:Pcnx2	UTSW	8	125759248	missense	probably benign	0.27
R2216:Pcnx2	UTSW	8	125888077	missense	probably benign	0.00
R2290:Pcnx2	UTSW	8	125877595	splice site	probably benign
R2373:Pcnx2	UTSW	8	125753451	missense	probably damaging	1.00
R2484:Pcnx2	UTSW	8	125891120	missense	probably damaging	1.00
R2849:Pcnx2	UTSW	8	125760927	missense	probably damaging	1.00
R2891:Pcnx2	UTSW	8	125891058	missense	probably damaging	1.00
R2892:Pcnx2	UTSW	8	125891058	missense	probably damaging	1.00
R2970:Pcnx2	UTSW	8	125801536	missense	probably damaging	1.00
R3013:Pcnx2	UTSW	8	125887770	missense	probably benign	0.05
R3608:Pcnx2	UTSW	8	125888101	missense	probably benign
R3876:Pcnx2	UTSW	8	125888158	missense	probably benign
R4349:Pcnx2	UTSW	8	125762851	missense	probably damaging	0.98
R4352:Pcnx2	UTSW	8	125762851	missense	probably damaging	0.98
R4353:Pcnx2	UTSW	8	125762851	missense	probably damaging	0.98
R4361:Pcnx2	UTSW	8	125768298	nonsense	probably null
R4735:Pcnx2	UTSW	8	125828041	critical splice donor site	probably null
R4749:Pcnx2	UTSW	8	125887588	missense	probably damaging	1.00
R4812:Pcnx2	UTSW	8	125865939	missense	probably benign	0.00
R4819:Pcnx2	UTSW	8	125855230	missense	probably benign	0.04
R4829:Pcnx2	UTSW	8	125861058	splice site	probably null
R4832:Pcnx2	UTSW	8	125752188	missense	probably damaging	0.99
R4876:Pcnx2	UTSW	8	125772108	missense	probably damaging	1.00
R4974:Pcnx2	UTSW	8	125851130	missense	probably benign	0.00
R5057:Pcnx2	UTSW	8	125855191	missense	possibly damaging	0.95
R5078:Pcnx2	UTSW	8	125752156	missense	probably benign
R5114:Pcnx2	UTSW	8	125838010	missense	possibly damaging	0.89
R5195:Pcnx2	UTSW	8	125801549	missense	possibly damaging	0.69
R5239:Pcnx2	UTSW	8	125861082	splice site	probably null
R5348:Pcnx2	UTSW	8	125818756	missense	probably damaging	1.00
R5398:Pcnx2	UTSW	8	125887948	missense	possibly damaging	0.63
R5448:Pcnx2	UTSW	8	125888149	missense	probably benign	0.14
R5534:Pcnx2	UTSW	8	125838015	missense	possibly damaging	0.65
R5624:Pcnx2	UTSW	8	125761523	critical splice donor site	probably null
R5629:Pcnx2	UTSW	8	125898041	missense	probably damaging	1.00
R5630:Pcnx2	UTSW	8	125860958	missense	probably damaging	0.99
R5782:Pcnx2	UTSW	8	125753484	missense	probably damaging	1.00
R5877:Pcnx2	UTSW	8	125753728	missense	probably damaging	0.99
R5879:Pcnx2	UTSW	8	125773946	missense	probably damaging	1.00
R6114:Pcnx2	UTSW	8	125773947	missense	probably damaging	1.00
R6152:Pcnx2	UTSW	8	125753752	missense	probably damaging	0.99
R6154:Pcnx2	UTSW	8	125762813	missense	probably damaging	1.00
R6283:Pcnx2	UTSW	8	125877586	missense	probably damaging	0.99
R6500:Pcnx2	UTSW	8	125753485	missense	probably damaging	1.00
R6629:Pcnx2	UTSW	8	125891112	missense	probably benign	0.00
R6708:Pcnx2	UTSW	8	125860953	critical splice donor site	probably null
R6736:Pcnx2	UTSW	8	125752317	splice site	probably null
R6748:Pcnx2	UTSW	8	125850335	missense	probably damaging	1.00
R6788:Pcnx2	UTSW	8	125772100	missense	probably damaging	1.00
R6849:Pcnx2	UTSW	8	125861210	missense	probably damaging	1.00
R6947:Pcnx2	UTSW	8	125850282	critical splice donor site	probably null
R7034:Pcnx2	UTSW	8	125785302	missense	probably damaging	1.00
R7100:Pcnx2	UTSW	8	125759114	missense	probably benign	0.16
R7130:Pcnx2	UTSW	8	125753584	nonsense	probably null
R7133:Pcnx2	UTSW	8	125801504	missense	probably benign	0.01
R7271:Pcnx2	UTSW	8	125886951	missense	probably benign
R7326:Pcnx2	UTSW	8	125887083	missense	probably damaging	1.00
R7373:Pcnx2	UTSW	8	125808027	missense	probably damaging	1.00
R7397:Pcnx2	UTSW	8	125890885	splice site	probably null
R7662:Pcnx2	UTSW	8	125818771	nonsense	probably null
R7693:Pcnx2	UTSW	8	125887125	missense	probably benign	0.09
R7726:Pcnx2	UTSW	8	125850330	missense	probably benign	0.00
R7745:Pcnx2	UTSW	8	125851107	missense	probably benign	0.04
R7792:Pcnx2	UTSW	8	125892018	missense	possibly damaging	0.63
R7797:Pcnx2	UTSW	8	125785348	missense	possibly damaging	0.70
R7921:Pcnx2	UTSW	8	125837863	missense	probably benign
R7984:Pcnx2	UTSW	8	125759126	missense	probably benign
R8098:Pcnx2	UTSW	8	125768301	missense	probably damaging	1.00
R8277:Pcnx2	UTSW	8	125866016	missense	probably damaging	1.00
R8312:Pcnx2	UTSW	8	125762850	missense	possibly damaging	0.69
R8354:Pcnx2	UTSW	8	125761618	missense	probably damaging	0.99
R8378:Pcnx2	UTSW	8	125760910	missense	probably damaging	1.00
R8713:Pcnx2	UTSW	8	125818786	missense	probably damaging	1.00
R8714:Pcnx2	UTSW	8	125773807	missense	probably benign
R8753:Pcnx2	UTSW	8	125887260	missense	probably benign	0.15
R8790:Pcnx2	UTSW	8	125877567	missense	probably benign
R8925:Pcnx2	UTSW	8	125887920	missense	probably benign	0.01
R8927:Pcnx2	UTSW	8	125887920	missense	probably benign	0.01
R8965:Pcnx2	UTSW	8	125759114	missense	probably benign	0.16
R9006:Pcnx2	UTSW	8	125887257	missense	probably benign	0.00
R9082:Pcnx2	UTSW	8	125887014	missense	probably damaging	1.00
R9202:Pcnx2	UTSW	8	125889677	critical splice acceptor site	probably null
R9315:Pcnx2	UTSW	8	125887380	missense	probably benign	0.00
R9434:Pcnx2	UTSW	8	125815773	missense	probably benign	0.00
R9660:Pcnx2	UTSW	8	125760853	missense	probably damaging	1.00
R9686:Pcnx2	UTSW	8	125866027	missense	probably benign
R9766:Pcnx2	UTSW	8	125761574	missense	probably damaging	1.00
R9778:Pcnx2	UTSW	8	125785437	missense	probably benign	0.00
R9792:Pcnx2	UTSW	8	125808081	missense	probably damaging	0.99
RF018:Pcnx2	UTSW	8	125877519	missense	probably damaging	1.00
Z1088:Pcnx2	UTSW	8	125826928	missense	probably damaging	1.00
Z1088:Pcnx2	UTSW	8	125866018	missense	probably damaging	1.00
Z1176:Pcnx2	UTSW	8	125761654	missense	probably damaging	1.00
Z1176:Pcnx2	UTSW	8	125838014	missense	probably benign	0.30
Z1177:Pcnx2	UTSW	8	125887960	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TTGACGCTGCTGGATGACTG -3'
(R):5'- TTCCTTCAGGGCTTGACCAG -3'

Sequencing Primer
(F):5'- CTGCTGGATGACTGGGTGTC -3'
(R):5'- AGTCCGTCCAGGCACATTCAG -3'

Posted On

2019-05-15