Incidental Mutation 'R7124:Pcnx2'
ID552215
Institutional Source Beutler Lab
Gene Symbol Pcnx2
Ensembl Gene ENSMUSG00000060212
Gene Namepecanex homolog 2
SynonymsPcnxl2, E330039K12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7124 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location125751508-125898317 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 125753617 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 1984 (P1984S)
Ref Sequence ENSEMBL: ENSMUSP00000042294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047239]
Predicted Effect probably damaging
Transcript: ENSMUST00000047239
AA Change: P1984S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000042294
Gene: ENSMUSG00000060212
AA Change: P1984S

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 94 104 N/A INTRINSIC
low complexity region 391 415 N/A INTRINSIC
low complexity region 457 476 N/A INTRINSIC
low complexity region 727 742 N/A INTRINSIC
low complexity region 806 817 N/A INTRINSIC
transmembrane domain 823 842 N/A INTRINSIC
transmembrane domain 849 866 N/A INTRINSIC
transmembrane domain 881 902 N/A INTRINSIC
transmembrane domain 934 956 N/A INTRINSIC
transmembrane domain 976 998 N/A INTRINSIC
transmembrane domain 1011 1030 N/A INTRINSIC
transmembrane domain 1080 1102 N/A INTRINSIC
transmembrane domain 1104 1126 N/A INTRINSIC
Pfam:Pecanex_C 1603 1828 3.5e-113 PFAM
low complexity region 1864 1889 N/A INTRINSIC
low complexity region 1968 1981 N/A INTRINSIC
low complexity region 2004 2019 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene contains coding mononucleotide repeats that are associated with tumors of high mcrosatellite instability (MSI-H). Defects in this gene are involved in the tumorigenesis of MSI-H colorectal carcinomas. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A C 3: 124,414,393 S212R probably benign Het
4930562C15Rik T C 16: 4,864,332 S170P probably benign Het
9330182O14Rik G A 15: 40,144,907 C59Y unknown Het
AA986860 A G 1: 130,742,887 E282G possibly damaging Het
Adam1a G T 5: 121,519,334 T632K probably benign Het
Aspg G T 12: 112,122,983 A402S probably damaging Het
Capn7 C T 14: 31,336,685 probably benign Het
Card9 C T 2: 26,356,884 probably null Het
Cdh13 T C 8: 118,968,173 V254A probably damaging Het
Colec10 T C 15: 54,462,371 V199A probably damaging Het
Copb2 T C 9: 98,577,053 S283P probably damaging Het
Csmd1 G T 8: 15,903,202 S3426R probably damaging Het
Cyp4f14 A G 17: 32,914,588 V98A probably benign Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dysf A G 6: 84,190,901 probably null Het
Eif4ebp1 T C 8: 27,273,419 V80A probably damaging Het
Eloa T A 4: 136,009,141 I565F probably damaging Het
Espn G T 4: 152,131,264 H513N probably benign Het
Fam83c C T 2: 155,829,571 S648N probably benign Het
Fdxr C T 11: 115,269,577 V351M probably benign Het
Fras1 A T 5: 96,714,401 D2213V probably damaging Het
Gbp4 T A 5: 105,119,959 I474F possibly damaging Het
Gm11639 T C 11: 104,738,274 F926S probably benign Het
Golgb1 T C 16: 36,913,673 V1135A probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Hipk2 A T 6: 38,818,478 Y285* probably null Het
Ifi27l2b T C 12: 103,451,320 I203V probably damaging Het
Itga10 T A 3: 96,651,765 M390K probably damaging Het
Itgb8 G T 12: 119,202,424 S124* probably null Het
Klhdc10 T A 6: 30,441,827 F173I probably damaging Het
Kng2 T G 16: 23,012,055 N168T probably damaging Het
Krtap24-1 T C 16: 88,611,546 T231A probably damaging Het
Lbx2 A T 6: 83,088,064 D194V probably damaging Het
Lrrc39 C A 3: 116,565,913 Q36K probably benign Het
Madd T C 2: 91,162,048 E1093G possibly damaging Het
Mfap3l A G 8: 60,671,269 T182A probably damaging Het
Myo9b T A 8: 71,333,701 Y670* probably null Het
Nbea A G 3: 55,992,444 L1428P probably damaging Het
Nkx2-3 T C 19: 43,614,806 Y284H possibly damaging Het
Nphp4 A G 4: 152,555,684 D1009G probably benign Het
Npy2r G A 3: 82,541,183 A95V probably damaging Het
Nuggc A G 14: 65,608,802 E70G probably damaging Het
Olfr1020 T C 2: 85,849,910 S153P probably benign Het
Olfr1028 T A 2: 85,951,473 S137T possibly damaging Het
Palld A T 8: 61,516,645 V1215D unknown Het
Pard6g T C 18: 80,117,125 I151T possibly damaging Het
Parp12 T C 6: 39,111,736 I189V probably benign Het
Parp4 A G 14: 56,602,799 I554V probably benign Het
Piwil4 T C 9: 14,736,900 M128V probably benign Het
Polr2a C A 11: 69,737,462 E1302* probably null Het
Psg17 C A 7: 18,814,496 G450V probably damaging Het
Psg17 C G 7: 18,814,497 G450R probably damaging Het
Rag1 T C 2: 101,643,783 E338G probably damaging Het
Rev3l A T 10: 39,822,167 K887* probably null Het
Rragd T C 4: 32,996,027 F124S possibly damaging Het
Scube1 A T 15: 83,629,511 probably null Het
Sfpq A T 4: 127,025,932 D490V possibly damaging Het
Smc1b G T 15: 85,071,597 Q1034K probably damaging Het
Smg7 T C 1: 152,878,080 N5S probably benign Het
Spata31d1a A C 13: 59,702,487 L609R probably damaging Het
Ssh2 A G 11: 77,454,338 K1050E probably benign Het
Stab1 G A 14: 31,160,867 T393I possibly damaging Het
Sult2a4 C T 7: 13,988,395 W49* probably null Het
Thrap3 A T 4: 126,180,438 S172T unknown Het
Tmem130 A G 5: 144,750,911 V205A probably damaging Het
Ube2d2b A G 5: 107,830,851 I123V probably benign Het
Unc79 G T 12: 103,061,393 L414F probably damaging Het
Vmn2r30 C T 7: 7,334,184 S151N probably benign Het
Vmn2r54 T A 7: 12,622,151 T443S probably benign Het
Zfp229 T A 17: 21,742,616 S51T probably damaging Het
Zfp617 T C 8: 71,932,540 L238P probably damaging Het
Zfp707 T A 15: 75,973,549 C87* probably null Het
Zfp853 T C 5: 143,289,607 K101R unknown Het
Other mutations in Pcnx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Pcnx2 APN 8 125887585 missense probably damaging 1.00
IGL00900:Pcnx2 APN 8 125863236 splice site probably benign
IGL01134:Pcnx2 APN 8 125863150 missense probably benign
IGL01370:Pcnx2 APN 8 125801483 missense probably damaging 0.96
IGL01452:Pcnx2 APN 8 125838032 missense probably damaging 1.00
IGL01477:Pcnx2 APN 8 125785305 missense probably damaging 1.00
IGL01610:Pcnx2 APN 8 125839633 missense possibly damaging 0.67
IGL01640:Pcnx2 APN 8 125801558 missense probably benign 0.14
IGL01645:Pcnx2 APN 8 125887917 missense probably damaging 1.00
IGL01876:Pcnx2 APN 8 125866031 missense probably benign 0.31
IGL01933:Pcnx2 APN 8 125761654 missense probably damaging 1.00
IGL02208:Pcnx2 APN 8 125752155 missense probably benign 0.30
IGL02573:Pcnx2 APN 8 125855273 missense probably benign 0.34
IGL02810:Pcnx2 APN 8 125887203 missense probably benign 0.03
IGL02859:Pcnx2 APN 8 125863173 missense probably damaging 1.00
IGL02879:Pcnx2 APN 8 125772057 missense probably damaging 1.00
IGL03202:Pcnx2 APN 8 125772044 missense probably damaging 0.98
IGL03259:Pcnx2 APN 8 125753649 missense probably benign 0.19
IGL03395:Pcnx2 APN 8 125887523 missense probably benign 0.00
IGL03410:Pcnx2 APN 8 125887040 missense probably damaging 1.00
gallen UTSW 8 125891120 missense probably damaging 1.00
hotzone UTSW 8 125891141 missense probably benign 0.00
R0107:Pcnx2 UTSW 8 125753586 missense probably benign 0.29
R0477:Pcnx2 UTSW 8 125761567 missense probably damaging 0.99
R0610:Pcnx2 UTSW 8 125839687 missense probably damaging 1.00
R0645:Pcnx2 UTSW 8 125760720 missense possibly damaging 0.64
R0894:Pcnx2 UTSW 8 125886926 splice site probably benign
R1083:Pcnx2 UTSW 8 125772104 missense probably damaging 1.00
R1199:Pcnx2 UTSW 8 125887314 missense possibly damaging 0.60
R1296:Pcnx2 UTSW 8 125773833 missense probably damaging 1.00
R1445:Pcnx2 UTSW 8 125752284 missense probably damaging 0.99
R1467:Pcnx2 UTSW 8 125753550 missense possibly damaging 0.77
R1467:Pcnx2 UTSW 8 125753550 missense possibly damaging 0.77
R1524:Pcnx2 UTSW 8 125891141 missense probably benign 0.00
R1537:Pcnx2 UTSW 8 125877449 missense possibly damaging 0.94
R1574:Pcnx2 UTSW 8 125773930 missense probably damaging 1.00
R1574:Pcnx2 UTSW 8 125773930 missense probably damaging 1.00
R1593:Pcnx2 UTSW 8 125759273 missense probably benign 0.11
R1598:Pcnx2 UTSW 8 125772086 missense probably benign 0.03
R1603:Pcnx2 UTSW 8 125839626 missense probably damaging 1.00
R1697:Pcnx2 UTSW 8 125850348 missense probably damaging 1.00
R1759:Pcnx2 UTSW 8 125773978 missense probably damaging 1.00
R1855:Pcnx2 UTSW 8 125807996 splice site probably benign
R1863:Pcnx2 UTSW 8 125818786 missense probably damaging 0.98
R1930:Pcnx2 UTSW 8 125887714 missense probably benign 0.10
R1967:Pcnx2 UTSW 8 125815683 missense possibly damaging 0.51
R1974:Pcnx2 UTSW 8 125887371 missense probably benign 0.00
R1998:Pcnx2 UTSW 8 125887143 missense probably damaging 1.00
R2034:Pcnx2 UTSW 8 125818667 critical splice donor site probably null
R2072:Pcnx2 UTSW 8 125761742 missense possibly damaging 0.90
R2096:Pcnx2 UTSW 8 125759248 missense probably benign 0.27
R2216:Pcnx2 UTSW 8 125888077 missense probably benign 0.00
R2290:Pcnx2 UTSW 8 125877595 splice site probably benign
R2373:Pcnx2 UTSW 8 125753451 missense probably damaging 1.00
R2484:Pcnx2 UTSW 8 125891120 missense probably damaging 1.00
R2849:Pcnx2 UTSW 8 125760927 missense probably damaging 1.00
R2891:Pcnx2 UTSW 8 125891058 missense probably damaging 1.00
R2892:Pcnx2 UTSW 8 125891058 missense probably damaging 1.00
R2970:Pcnx2 UTSW 8 125801536 missense probably damaging 1.00
R3013:Pcnx2 UTSW 8 125887770 missense probably benign 0.05
R3608:Pcnx2 UTSW 8 125888101 missense probably benign
R3876:Pcnx2 UTSW 8 125888158 missense probably benign
R4349:Pcnx2 UTSW 8 125762851 missense probably damaging 0.98
R4352:Pcnx2 UTSW 8 125762851 missense probably damaging 0.98
R4353:Pcnx2 UTSW 8 125762851 missense probably damaging 0.98
R4361:Pcnx2 UTSW 8 125768298 nonsense probably null
R4735:Pcnx2 UTSW 8 125828041 critical splice donor site probably null
R4749:Pcnx2 UTSW 8 125887588 missense probably damaging 1.00
R4812:Pcnx2 UTSW 8 125865939 missense probably benign 0.00
R4819:Pcnx2 UTSW 8 125855230 missense probably benign 0.04
R4829:Pcnx2 UTSW 8 125861058 splice site probably null
R4832:Pcnx2 UTSW 8 125752188 missense probably damaging 0.99
R4876:Pcnx2 UTSW 8 125772108 missense probably damaging 1.00
R4974:Pcnx2 UTSW 8 125851130 missense probably benign 0.00
R5057:Pcnx2 UTSW 8 125855191 missense possibly damaging 0.95
R5078:Pcnx2 UTSW 8 125752156 missense probably benign
R5114:Pcnx2 UTSW 8 125838010 missense possibly damaging 0.89
R5195:Pcnx2 UTSW 8 125801549 missense possibly damaging 0.69
R5239:Pcnx2 UTSW 8 125861082 splice site probably null
R5348:Pcnx2 UTSW 8 125818756 missense probably damaging 1.00
R5398:Pcnx2 UTSW 8 125887948 missense possibly damaging 0.63
R5448:Pcnx2 UTSW 8 125888149 missense probably benign 0.14
R5534:Pcnx2 UTSW 8 125838015 missense possibly damaging 0.65
R5624:Pcnx2 UTSW 8 125761523 critical splice donor site probably null
R5629:Pcnx2 UTSW 8 125898041 missense probably damaging 1.00
R5630:Pcnx2 UTSW 8 125860958 missense probably damaging 0.99
R5782:Pcnx2 UTSW 8 125753484 missense probably damaging 1.00
R5877:Pcnx2 UTSW 8 125753728 missense probably damaging 0.99
R5879:Pcnx2 UTSW 8 125773946 missense probably damaging 1.00
R6114:Pcnx2 UTSW 8 125773947 missense probably damaging 1.00
R6152:Pcnx2 UTSW 8 125753752 missense probably damaging 0.99
R6154:Pcnx2 UTSW 8 125762813 missense probably damaging 1.00
R6283:Pcnx2 UTSW 8 125877586 missense probably damaging 0.99
R6500:Pcnx2 UTSW 8 125753485 missense probably damaging 1.00
R6629:Pcnx2 UTSW 8 125891112 missense probably benign 0.00
R6708:Pcnx2 UTSW 8 125860953 critical splice donor site probably null
R6736:Pcnx2 UTSW 8 125752317 splice site probably null
R6748:Pcnx2 UTSW 8 125850335 missense probably damaging 1.00
R6788:Pcnx2 UTSW 8 125772100 missense probably damaging 1.00
R6849:Pcnx2 UTSW 8 125861210 missense probably damaging 1.00
R6947:Pcnx2 UTSW 8 125850282 critical splice donor site probably null
R7034:Pcnx2 UTSW 8 125785302 missense probably damaging 1.00
R7100:Pcnx2 UTSW 8 125759114 missense probably benign 0.16
R7130:Pcnx2 UTSW 8 125753584 nonsense probably null
R7133:Pcnx2 UTSW 8 125801504 missense probably benign 0.01
R7271:Pcnx2 UTSW 8 125886951 missense probably benign
R7326:Pcnx2 UTSW 8 125887083 missense probably damaging 1.00
R7373:Pcnx2 UTSW 8 125808027 missense probably damaging 1.00
R7397:Pcnx2 UTSW 8 125890885 splice site probably null
R7662:Pcnx2 UTSW 8 125818771 nonsense probably null
R7693:Pcnx2 UTSW 8 125887125 missense probably benign 0.09
R7726:Pcnx2 UTSW 8 125850330 missense probably benign 0.00
R7745:Pcnx2 UTSW 8 125851107 missense probably benign 0.04
R7792:Pcnx2 UTSW 8 125892018 missense possibly damaging 0.63
R7797:Pcnx2 UTSW 8 125785348 missense possibly damaging 0.70
R7921:Pcnx2 UTSW 8 125837863 missense probably benign
R7984:Pcnx2 UTSW 8 125759126 missense probably benign
R8098:Pcnx2 UTSW 8 125768301 missense probably damaging 1.00
R8277:Pcnx2 UTSW 8 125866016 missense probably damaging 1.00
R8312:Pcnx2 UTSW 8 125762850 missense possibly damaging 0.69
R8354:Pcnx2 UTSW 8 125761618 missense probably damaging 0.99
R8378:Pcnx2 UTSW 8 125760910 missense probably damaging 1.00
R8713:Pcnx2 UTSW 8 125818786 missense probably damaging 1.00
R8714:Pcnx2 UTSW 8 125773807 missense probably benign
R8753:Pcnx2 UTSW 8 125887260 missense probably benign 0.15
R8790:Pcnx2 UTSW 8 125877567 missense probably benign
RF018:Pcnx2 UTSW 8 125877519 missense probably damaging 1.00
Z1088:Pcnx2 UTSW 8 125826928 missense probably damaging 1.00
Z1088:Pcnx2 UTSW 8 125866018 missense probably damaging 1.00
Z1176:Pcnx2 UTSW 8 125761654 missense probably damaging 1.00
Z1176:Pcnx2 UTSW 8 125838014 missense probably benign 0.30
Z1177:Pcnx2 UTSW 8 125887960 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGACGCTGCTGGATGACTG -3'
(R):5'- TTCCTTCAGGGCTTGACCAG -3'

Sequencing Primer
(F):5'- CTGCTGGATGACTGGGTGTC -3'
(R):5'- AGTCCGTCCAGGCACATTCAG -3'
Posted On2019-05-15