Mutagenetix > Incidental Mutation

Incidental Mutation 'R7124:Rev3l'

552218

Institutional Source

Beutler Lab

Gene Symbol

Rev3l

Ensembl Gene

ENSMUSG00000019841

Gene Name

REV3 like, DNA directed polymerase zeta catalytic subunit

Synonyms

Sez4, Rev

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7124 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

39732118-39875211 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 39822167 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 887 (K887*)

Ref Sequence

ENSEMBL: ENSMUSP00000019986 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019986] [ENSMUST00000131186] [ENSMUST00000139803] [ENSMUST00000164763]

AlphaFold

no structure available at present

PDB Structure

Structure of the Rev1 CTD-Rev3/7-Pol kappa RIR complex [X-RAY DIFFRACTION]

Predicted Effect

probably null
Transcript: ENSMUST00000019986
AA Change: K887*

SMART Domains

Protein: ENSMUSP00000019986
Gene: ENSMUSG00000019841
AA Change: K887*

Domain	Start	End	E-Value	Type
Pfam:DNA_pol_B_exo1	43	201	1.6e-10	PFAM
low complexity region	494	506	N/A	INTRINSIC
low complexity region	959	969	N/A	INTRINSIC
low complexity region	1042	1057	N/A	INTRINSIC
low complexity region	1205	1216	N/A	INTRINSIC
low complexity region	1424	1440	N/A	INTRINSIC
low complexity region	1569	1595	N/A	INTRINSIC
Blast:POLBc	1825	2243	1e-163	BLAST
PDB:4GK5\|D	1863	1895	4e-13	PDB
POLBc	2308	2783	5.32e-105	SMART
Blast:POLBc	2860	2926	2e-14	BLAST
Pfam:zf-C4pol	3034	3103	8.2e-16	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000131186

Predicted Effect

probably benign
Transcript: ENSMUST00000139803

SMART Domains

Protein: ENSMUSP00000115630
Gene: ENSMUSG00000019841

Domain	Start	End	E-Value	Type
Blast:POLBc	1	369	1e-155	BLAST
POLBc	434	805	4.77e-34	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000164763
AA Change: K887*

SMART Domains

Protein: ENSMUSP00000131519
Gene: ENSMUSG00000019841
AA Change: K887*

Domain	Start	End	E-Value	Type
Pfam:DNA_pol_B_exo1	43	200	1.3e-11	PFAM
low complexity region	494	506	N/A	INTRINSIC
Pfam:DUF4683	745	1132	1.7e-162	PFAM
low complexity region	1205	1216	N/A	INTRINSIC
low complexity region	1424	1440	N/A	INTRINSIC
low complexity region	1569	1595	N/A	INTRINSIC
Blast:POLBc	1825	2243	1e-163	BLAST
PDB:4GK5\|D	1863	1895	4e-13	PDB
POLBc	2308	2783	5.32e-105	SMART
Blast:POLBc	2860	2926	2e-14	BLAST
Pfam:zf-C4pol	3034	3102	6.1e-15	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

97% (72/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene represents the catalytic subunit of DNA polymerase zeta, which functions in translesion DNA synthesis. The encoded protein can be found in mitochondria, where it protects DNA from damage. Defects in this gene are a cause of Mobius syndrome. [provided by RefSeq, Jan 2017]
PHENOTYPE: Nullizygous mice exhibit complete embryonic lethality and abnormal embryonic tissue morphology with widespread degeneration and cell death. Mice carrying the amino acid substitution of phenylalanine for leucine at position 2610 display alterations in somatic hypermutation frequency and specificity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	C	3: 124,414,393	S212R	probably benign	Het
4930562C15Rik	T	C	16: 4,864,332	S170P	probably benign	Het
9330182O14Rik	G	A	15: 40,144,907	C59Y	unknown	Het
AA986860	A	G	1: 130,742,887	E282G	possibly damaging	Het
Adam1a	G	T	5: 121,519,334	T632K	probably benign	Het
Aspg	G	T	12: 112,122,983	A402S	probably damaging	Het
Capn7	C	T	14: 31,336,685		probably benign	Het
Card9	C	T	2: 26,356,884		probably null	Het
Cdh13	T	C	8: 118,968,173	V254A	probably damaging	Het
Colec10	T	C	15: 54,462,371	V199A	probably damaging	Het
Copb2	T	C	9: 98,577,053	S283P	probably damaging	Het
Csmd1	G	T	8: 15,903,202	S3426R	probably damaging	Het
Cyp4f14	A	G	17: 32,914,588	V98A	probably benign	Het
Disp1	C	A	1: 183,087,466	R1130L	probably damaging	Het
Dysf	A	G	6: 84,190,901		probably null	Het
Eif4ebp1	T	C	8: 27,273,419	V80A	probably damaging	Het
Eloa	T	A	4: 136,009,141	I565F	probably damaging	Het
Espn	G	T	4: 152,131,264	H513N	probably benign	Het
Fam83c	C	T	2: 155,829,571	S648N	probably benign	Het
Fdxr	C	T	11: 115,269,577	V351M	probably benign	Het
Fras1	A	T	5: 96,714,401	D2213V	probably damaging	Het
Gbp4	T	A	5: 105,119,959	I474F	possibly damaging	Het
Gm11639	T	C	11: 104,738,274	F926S	probably benign	Het
Golgb1	T	C	16: 36,913,673	V1135A	probably benign	Het
Gpt2	G	A	8: 85,518,052	E325K	probably benign	Het
Hipk2	A	T	6: 38,818,478	Y285*	probably null	Het
Ifi27l2b	T	C	12: 103,451,320	I203V	probably damaging	Het
Itga10	T	A	3: 96,651,765	M390K	probably damaging	Het
Itgb8	G	T	12: 119,202,424	S124*	probably null	Het
Klhdc10	T	A	6: 30,441,827	F173I	probably damaging	Het
Kng2	T	G	16: 23,012,055	N168T	probably damaging	Het
Krtap24-1	T	C	16: 88,611,546	T231A	probably damaging	Het
Lbx2	A	T	6: 83,088,064	D194V	probably damaging	Het
Lrrc39	C	A	3: 116,565,913	Q36K	probably benign	Het
Madd	T	C	2: 91,162,048	E1093G	possibly damaging	Het
Mfap3l	A	G	8: 60,671,269	T182A	probably damaging	Het
Myo9b	T	A	8: 71,333,701	Y670*	probably null	Het
Nbea	A	G	3: 55,992,444	L1428P	probably damaging	Het
Nkx2-3	T	C	19: 43,614,806	Y284H	possibly damaging	Het
Nphp4	A	G	4: 152,555,684	D1009G	probably benign	Het
Npy2r	G	A	3: 82,541,183	A95V	probably damaging	Het
Nuggc	A	G	14: 65,608,802	E70G	probably damaging	Het
Olfr1020	T	C	2: 85,849,910	S153P	probably benign	Het
Olfr1028	T	A	2: 85,951,473	S137T	possibly damaging	Het
Palld	A	T	8: 61,516,645	V1215D	unknown	Het
Pard6g	T	C	18: 80,117,125	I151T	possibly damaging	Het
Parp12	T	C	6: 39,111,736	I189V	probably benign	Het
Parp4	A	G	14: 56,602,799	I554V	probably benign	Het
Pcnx2	G	A	8: 125,753,617	P1984S	probably damaging	Het
Piwil4	T	C	9: 14,736,900	M128V	probably benign	Het
Polr2a	C	A	11: 69,737,462	E1302*	probably null	Het
Psg17	C	A	7: 18,814,496	G450V	probably damaging	Het
Psg17	C	G	7: 18,814,497	G450R	probably damaging	Het
Rag1	T	C	2: 101,643,783	E338G	probably damaging	Het
Rragd	T	C	4: 32,996,027	F124S	possibly damaging	Het
Scube1	A	T	15: 83,629,511		probably null	Het
Sfpq	A	T	4: 127,025,932	D490V	possibly damaging	Het
Smc1b	G	T	15: 85,071,597	Q1034K	probably damaging	Het
Smg7	T	C	1: 152,878,080	N5S	probably benign	Het
Spata31d1a	A	C	13: 59,702,487	L609R	probably damaging	Het
Ssh2	A	G	11: 77,454,338	K1050E	probably benign	Het
Stab1	G	A	14: 31,160,867	T393I	possibly damaging	Het
Sult2a4	C	T	7: 13,988,395	W49*	probably null	Het
Thrap3	A	T	4: 126,180,438	S172T	unknown	Het
Tmem130	A	G	5: 144,750,911	V205A	probably damaging	Het
Ube2d2b	A	G	5: 107,830,851	I123V	probably benign	Het
Unc79	G	T	12: 103,061,393	L414F	probably damaging	Het
Vmn2r30	C	T	7: 7,334,184	S151N	probably benign	Het
Vmn2r54	T	A	7: 12,622,151	T443S	probably benign	Het
Zfp229	T	A	17: 21,742,616	S51T	probably damaging	Het
Zfp617	T	C	8: 71,932,540	L238P	probably damaging	Het
Zfp707	T	A	15: 75,973,549	C87*	probably null	Het
Zfp853	T	C	5: 143,289,607	K101R	unknown	Het

Other mutations in Rev3l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Rev3l	APN	10	39806969	missense	probably benign
IGL00815:Rev3l	APN	10	39859153	missense	possibly damaging	0.79
IGL00964:Rev3l	APN	10	39864806	missense	probably benign	0.39
IGL01765:Rev3l	APN	10	39828265	missense	probably benign	0.00
IGL01792:Rev3l	APN	10	39823340	missense	probably benign
IGL01950:Rev3l	APN	10	39821157	missense	probably damaging	1.00
IGL01963:Rev3l	APN	10	39822737	missense	possibly damaging	0.90
IGL02089:Rev3l	APN	10	39825099	missense	probably damaging	1.00
IGL02288:Rev3l	APN	10	39828216	missense	probably benign
IGL02381:Rev3l	APN	10	39821346	missense	possibly damaging	0.83
IGL02409:Rev3l	APN	10	39821148	missense	possibly damaging	0.75
IGL02434:Rev3l	APN	10	39822591	missense	probably damaging	1.00
IGL02570:Rev3l	APN	10	39848013	missense	possibly damaging	0.68
IGL02581:Rev3l	APN	10	39821281	missense	probably benign	0.10
IGL02654:Rev3l	APN	10	39862734	missense	probably damaging	1.00
IGL02720:Rev3l	APN	10	39822395	nonsense	probably null
IGL02746:Rev3l	APN	10	39824589	missense	probably damaging	0.99
IGL02829:Rev3l	APN	10	39825240	missense	probably damaging	1.00
IGL02961:Rev3l	APN	10	39827945	missense	possibly damaging	0.65
IGL02974:Rev3l	APN	10	39862747	nonsense	probably null
IGL03029:Rev3l	APN	10	39828486	missense	probably benign	0.34
IGL03153:Rev3l	APN	10	39806878	missense	probably damaging	1.00
IGL03172:Rev3l	APN	10	39824790	missense	probably benign	0.10
R0068:Rev3l	UTSW	10	39824831	missense	possibly damaging	0.68
R0068:Rev3l	UTSW	10	39824831	missense	possibly damaging	0.68
R0153:Rev3l	UTSW	10	39874128	nonsense	probably null
R0308:Rev3l	UTSW	10	39824894	missense	probably benign	0.09
R0355:Rev3l	UTSW	10	39817286	missense	probably damaging	1.00
R0513:Rev3l	UTSW	10	39828143	missense	probably benign	0.00
R0523:Rev3l	UTSW	10	39848049	missense	probably benign	0.02
R0559:Rev3l	UTSW	10	39824487	missense	probably damaging	1.00
R0761:Rev3l	UTSW	10	39874195	missense	probably benign	0.32
R1023:Rev3l	UTSW	10	39832639	missense	probably damaging	1.00
R1159:Rev3l	UTSW	10	39851925	nonsense	probably null
R1398:Rev3l	UTSW	10	39821583	missense	probably benign	0.05
R1478:Rev3l	UTSW	10	39783333	critical splice donor site	probably null
R1517:Rev3l	UTSW	10	39838443	missense	probably benign	0.34
R1527:Rev3l	UTSW	10	39822822	missense	probably damaging	1.00
R1635:Rev3l	UTSW	10	39806662	missense	probably damaging	0.98
R1695:Rev3l	UTSW	10	39824616	missense	probably damaging	0.97
R1695:Rev3l	UTSW	10	39824615	nonsense	probably null
R1782:Rev3l	UTSW	10	39799885	missense	probably benign
R1815:Rev3l	UTSW	10	39822871	missense	probably benign	0.41
R1818:Rev3l	UTSW	10	39828424	missense	probably benign	0.05
R2039:Rev3l	UTSW	10	39824444	missense	probably damaging	1.00
R2071:Rev3l	UTSW	10	39824353	missense	probably benign	0.17
R2101:Rev3l	UTSW	10	39828096	missense	probably benign	0.00
R2141:Rev3l	UTSW	10	39848049	missense	probably benign	0.02
R2883:Rev3l	UTSW	10	39825156	missense	probably damaging	1.00
R3787:Rev3l	UTSW	10	39846210	missense	probably damaging	0.97
R3910:Rev3l	UTSW	10	39820556	missense	probably damaging	1.00
R3912:Rev3l	UTSW	10	39820556	missense	probably damaging	1.00
R3913:Rev3l	UTSW	10	39820556	missense	probably damaging	1.00
R4590:Rev3l	UTSW	10	39806933	missense	probably damaging	1.00
R4631:Rev3l	UTSW	10	39828416	missense	probably benign	0.44
R4633:Rev3l	UTSW	10	39846186	missense	probably damaging	1.00
R4707:Rev3l	UTSW	10	39823397	missense	probably damaging	0.99
R4724:Rev3l	UTSW	10	39846806	nonsense	probably null
R4810:Rev3l	UTSW	10	39823725	missense	probably benign	0.01
R4857:Rev3l	UTSW	10	39838459	missense	probably damaging	1.00
R4882:Rev3l	UTSW	10	39821460	missense	possibly damaging	0.89
R4928:Rev3l	UTSW	10	39823985	missense	probably benign	0.30
R4970:Rev3l	UTSW	10	39823330	missense	probably benign	0.00
R4977:Rev3l	UTSW	10	39823578	missense	possibly damaging	0.80
R5112:Rev3l	UTSW	10	39823330	missense	probably benign	0.00
R5261:Rev3l	UTSW	10	39846729	missense	probably damaging	1.00
R5419:Rev3l	UTSW	10	39824931	missense	possibly damaging	0.95
R5570:Rev3l	UTSW	10	39852075	critical splice donor site	probably null
R5628:Rev3l	UTSW	10	39822967	missense	probably damaging	0.98
R5689:Rev3l	UTSW	10	39794958	missense	probably damaging	1.00
R5781:Rev3l	UTSW	10	39823093	missense	probably benign	0.00
R5829:Rev3l	UTSW	10	39806906	missense	probably damaging	0.97
R5984:Rev3l	UTSW	10	39742689	intron	probably benign
R5990:Rev3l	UTSW	10	39823811	missense	probably benign	0.17
R6054:Rev3l	UTSW	10	39824150	missense	probably benign	0.01
R6171:Rev3l	UTSW	10	39862713	nonsense	probably null
R6220:Rev3l	UTSW	10	39822779	missense	probably damaging	1.00
R6520:Rev3l	UTSW	10	39822702	missense	probably benign	0.06
R6798:Rev3l	UTSW	10	39854763	missense	probably damaging	1.00
R6811:Rev3l	UTSW	10	39830921	nonsense	probably null
R6812:Rev3l	UTSW	10	39823548	missense	probably benign
R6904:Rev3l	UTSW	10	39821481	missense	probably benign
R6905:Rev3l	UTSW	10	39817327	missense	probably benign	0.18
R6938:Rev3l	UTSW	10	39862710	missense	probably damaging	1.00
R7037:Rev3l	UTSW	10	39851975	missense	probably damaging	1.00
R7286:Rev3l	UTSW	10	39823605	missense	probably damaging	0.99
R7385:Rev3l	UTSW	10	39823682	missense	probably benign	0.01
R7575:Rev3l	UTSW	10	39821445	missense	possibly damaging	0.56
R7596:Rev3l	UTSW	10	39821538	missense	probably damaging	1.00
R7597:Rev3l	UTSW	10	39822884	missense	probably damaging	1.00
R7670:Rev3l	UTSW	10	39836722	missense	probably benign	0.01
R7804:Rev3l	UTSW	10	39823485	missense	probably benign	0.34
R7818:Rev3l	UTSW	10	39823902	missense	possibly damaging	0.54
R7874:Rev3l	UTSW	10	39822495	missense	possibly damaging	0.72
R7991:Rev3l	UTSW	10	39863738	missense	possibly damaging	0.52
R8059:Rev3l	UTSW	10	39843495	missense	probably damaging	1.00
R8174:Rev3l	UTSW	10	39859115	missense	probably damaging	1.00
R8187:Rev3l	UTSW	10	39806697	missense	probably benign
R8299:Rev3l	UTSW	10	39821541	missense	probably benign	0.01
R8352:Rev3l	UTSW	10	39822903	missense	probably damaging	1.00
R8452:Rev3l	UTSW	10	39822903	missense	probably damaging	1.00
R8468:Rev3l	UTSW	10	39827991	missense	probably damaging	0.99
R8487:Rev3l	UTSW	10	39806848	missense	probably damaging	1.00
R8512:Rev3l	UTSW	10	39821538	missense	probably damaging	1.00
R8554:Rev3l	UTSW	10	39806842	missense	probably benign	0.12
R8702:Rev3l	UTSW	10	39838469	nonsense	probably null
R8848:Rev3l	UTSW	10	39846709	missense	probably damaging	0.99
R8857:Rev3l	UTSW	10	39794969	nonsense	probably null
R8870:Rev3l	UTSW	10	39862790	missense	probably damaging	1.00
R9094:Rev3l	UTSW	10	39824813	missense	probably benign
R9175:Rev3l	UTSW	10	39854768	missense	possibly damaging	0.83
R9286:Rev3l	UTSW	10	39806951	missense	possibly damaging	0.54
R9299:Rev3l	UTSW	10	39848003	missense	probably damaging	1.00
R9307:Rev3l	UTSW	10	39817153	missense	probably benign	0.01
R9337:Rev3l	UTSW	10	39822854	missense	probably benign	0.40
R9342:Rev3l	UTSW	10	39821462	missense	probably benign
R9389:Rev3l	UTSW	10	39822971	missense	possibly damaging	0.47
R9395:Rev3l	UTSW	10	39859223	critical splice donor site	probably null
R9458:Rev3l	UTSW	10	39783251	missense	probably damaging	1.00
R9481:Rev3l	UTSW	10	39825037	missense	probably benign
R9646:Rev3l	UTSW	10	39822444	missense	probably damaging	1.00
R9686:Rev3l	UTSW	10	39867388	missense	possibly damaging	0.67
X0022:Rev3l	UTSW	10	39828607	critical splice donor site	probably null
Z1088:Rev3l	UTSW	10	39824318	missense	probably benign	0.41

Predicted Primers

PCR Primer
(F):5'- CAATCTGGCAATAAACCTTCCAGG -3'
(R):5'- TCGGGATTTGAGAGTTCCATC -3'

Sequencing Primer
(F):5'- GCCACAAAAGACAGCTGT -3'
(R):5'- CACCGATTTCCATGGGATGAG -3'

Posted On

2019-05-15