Incidental Mutation 'R7124:Ssh2'
ID552220
Institutional Source Beutler Lab
Gene Symbol Ssh2
Ensembl Gene ENSMUSG00000037926
Gene Nameslingshot protein phosphatase 2
SynonymsSSH-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.289) question?
Stock #R7124 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location77216287-77460220 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77454338 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1050 (K1050E)
Ref Sequence ENSEMBL: ENSMUSP00000137933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037912] [ENSMUST00000181283]
Predicted Effect probably benign
Transcript: ENSMUST00000037912
AA Change: K1044E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000042625
Gene: ENSMUSG00000037926
AA Change: K1044E

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
Pfam:DEK_C 251 302 3.1e-13 PFAM
DSPc 307 445 2.2e-41 SMART
low complexity region 459 469 N/A INTRINSIC
low complexity region 871 882 N/A INTRINSIC
low complexity region 1002 1014 N/A INTRINSIC
low complexity region 1370 1385 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000181283
AA Change: K1050E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000137933
Gene: ENSMUSG00000037926
AA Change: K1050E

DomainStartEndE-ValueType
Pfam:DEK_C 256 309 1.7e-18 PFAM
DSPc 313 451 2.2e-41 SMART
low complexity region 465 475 N/A INTRINSIC
low complexity region 877 888 N/A INTRINSIC
low complexity region 1008 1020 N/A INTRINSIC
low complexity region 1376 1391 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein tyrosine phosphatase that plays a key role in the regulation of actin filaments. The encoded protein dephosphorylates and activates cofilin, which promotes actin filament depolymerization. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A C 3: 124,414,393 S212R probably benign Het
4930562C15Rik T C 16: 4,864,332 S170P probably benign Het
9330182O14Rik G A 15: 40,144,907 C59Y unknown Het
AA986860 A G 1: 130,742,887 E282G possibly damaging Het
Adam1a G T 5: 121,519,334 T632K probably benign Het
Aspg G T 12: 112,122,983 A402S probably damaging Het
Capn7 C T 14: 31,336,685 probably benign Het
Card9 C T 2: 26,356,884 probably null Het
Cdh13 T C 8: 118,968,173 V254A probably damaging Het
Colec10 T C 15: 54,462,371 V199A probably damaging Het
Copb2 T C 9: 98,577,053 S283P probably damaging Het
Csmd1 G T 8: 15,903,202 S3426R probably damaging Het
Cyp4f14 A G 17: 32,914,588 V98A probably benign Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dysf A G 6: 84,190,901 probably null Het
Eif4ebp1 T C 8: 27,273,419 V80A probably damaging Het
Eloa T A 4: 136,009,141 I565F probably damaging Het
Espn G T 4: 152,131,264 H513N probably benign Het
Fam83c C T 2: 155,829,571 S648N probably benign Het
Fdxr C T 11: 115,269,577 V351M probably benign Het
Fras1 A T 5: 96,714,401 D2213V probably damaging Het
Gbp4 T A 5: 105,119,959 I474F possibly damaging Het
Gm11639 T C 11: 104,738,274 F926S probably benign Het
Golgb1 T C 16: 36,913,673 V1135A probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Hipk2 A T 6: 38,818,478 Y285* probably null Het
Ifi27l2b T C 12: 103,451,320 I203V probably damaging Het
Itga10 T A 3: 96,651,765 M390K probably damaging Het
Itgb8 G T 12: 119,202,424 S124* probably null Het
Klhdc10 T A 6: 30,441,827 F173I probably damaging Het
Kng2 T G 16: 23,012,055 N168T probably damaging Het
Krtap24-1 T C 16: 88,611,546 T231A probably damaging Het
Lbx2 A T 6: 83,088,064 D194V probably damaging Het
Lrrc39 C A 3: 116,565,913 Q36K probably benign Het
Madd T C 2: 91,162,048 E1093G possibly damaging Het
Mfap3l A G 8: 60,671,269 T182A probably damaging Het
Myo9b T A 8: 71,333,701 Y670* probably null Het
Nbea A G 3: 55,992,444 L1428P probably damaging Het
Nkx2-3 T C 19: 43,614,806 Y284H possibly damaging Het
Nphp4 A G 4: 152,555,684 D1009G probably benign Het
Npy2r G A 3: 82,541,183 A95V probably damaging Het
Nuggc A G 14: 65,608,802 E70G probably damaging Het
Olfr1020 T C 2: 85,849,910 S153P probably benign Het
Olfr1028 T A 2: 85,951,473 S137T possibly damaging Het
Palld A T 8: 61,516,645 V1215D unknown Het
Pard6g T C 18: 80,117,125 I151T possibly damaging Het
Parp12 T C 6: 39,111,736 I189V probably benign Het
Parp4 A G 14: 56,602,799 I554V probably benign Het
Pcnx2 G A 8: 125,753,617 P1984S probably damaging Het
Piwil4 T C 9: 14,736,900 M128V probably benign Het
Polr2a C A 11: 69,737,462 E1302* probably null Het
Psg17 C A 7: 18,814,496 G450V probably damaging Het
Psg17 C G 7: 18,814,497 G450R probably damaging Het
Rag1 T C 2: 101,643,783 E338G probably damaging Het
Rev3l A T 10: 39,822,167 K887* probably null Het
Rragd T C 4: 32,996,027 F124S possibly damaging Het
Scube1 A T 15: 83,629,511 probably null Het
Sfpq A T 4: 127,025,932 D490V possibly damaging Het
Smc1b G T 15: 85,071,597 Q1034K probably damaging Het
Smg7 T C 1: 152,878,080 N5S probably benign Het
Spata31d1a A C 13: 59,702,487 L609R probably damaging Het
Stab1 G A 14: 31,160,867 T393I possibly damaging Het
Sult2a4 C T 7: 13,988,395 W49* probably null Het
Thrap3 A T 4: 126,180,438 S172T unknown Het
Tmem130 A G 5: 144,750,911 V205A probably damaging Het
Ube2d2b A G 5: 107,830,851 I123V probably benign Het
Unc79 G T 12: 103,061,393 L414F probably damaging Het
Vmn2r30 C T 7: 7,334,184 S151N probably benign Het
Vmn2r54 T A 7: 12,622,151 T443S probably benign Het
Zfp229 T A 17: 21,742,616 S51T probably damaging Het
Zfp617 T C 8: 71,932,540 L238P probably damaging Het
Zfp707 T A 15: 75,973,549 C87* probably null Het
Zfp853 T C 5: 143,289,607 K101R unknown Het
Other mutations in Ssh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00811:Ssh2 APN 11 77441926 missense probably damaging 1.00
IGL01141:Ssh2 APN 11 77449726 missense probably damaging 1.00
IGL01520:Ssh2 APN 11 77449906 missense probably damaging 1.00
IGL01803:Ssh2 APN 11 77425330 missense probably damaging 0.99
IGL01989:Ssh2 APN 11 77453685 missense possibly damaging 0.79
IGL02322:Ssh2 APN 11 77416413 critical splice acceptor site probably null
IGL02466:Ssh2 APN 11 77416407 splice site probably benign
IGL02683:Ssh2 APN 11 77398256 missense probably damaging 0.99
IGL02706:Ssh2 APN 11 77453406 missense possibly damaging 0.68
IGL02719:Ssh2 APN 11 77425587 missense probably damaging 1.00
IGL02721:Ssh2 APN 11 77454725 nonsense probably null
IGL02732:Ssh2 APN 11 77437776 splice site probably null
IGL02745:Ssh2 APN 11 77455407 missense probably damaging 1.00
IGL02993:Ssh2 APN 11 77453544 missense probably damaging 1.00
IGL03000:Ssh2 APN 11 77421206 splice site probably benign
david UTSW 11 77425593 missense probably damaging 1.00
faba UTSW 11 77441985 missense probably damaging 1.00
goliath UTSW 11 77453523 missense possibly damaging 0.48
Vicia UTSW 11 77454966 missense possibly damaging 0.68
IGL03055:Ssh2 UTSW 11 77408195 nonsense probably null
R0024:Ssh2 UTSW 11 77454966 missense possibly damaging 0.68
R0374:Ssh2 UTSW 11 77408143 missense probably damaging 1.00
R0539:Ssh2 UTSW 11 77454794 missense probably benign 0.11
R0834:Ssh2 UTSW 11 77437633 missense possibly damaging 0.87
R1714:Ssh2 UTSW 11 77454024 missense possibly damaging 0.94
R1743:Ssh2 UTSW 11 77437756 missense probably damaging 1.00
R1889:Ssh2 UTSW 11 77449745 missense probably damaging 1.00
R1895:Ssh2 UTSW 11 77449745 missense probably damaging 1.00
R3945:Ssh2 UTSW 11 77454668 missense possibly damaging 0.93
R3947:Ssh2 UTSW 11 77398256 missense probably damaging 0.99
R3948:Ssh2 UTSW 11 77398256 missense probably damaging 0.99
R4133:Ssh2 UTSW 11 77421269 missense probably damaging 1.00
R4256:Ssh2 UTSW 11 77408183 missense possibly damaging 0.48
R4499:Ssh2 UTSW 11 77393067 nonsense probably null
R4548:Ssh2 UTSW 11 77450184 missense probably benign 0.20
R4644:Ssh2 UTSW 11 77449576 missense possibly damaging 0.46
R4690:Ssh2 UTSW 11 77455205 missense possibly damaging 0.62
R4788:Ssh2 UTSW 11 77429798 missense probably damaging 1.00
R4919:Ssh2 UTSW 11 77425320 missense possibly damaging 0.91
R5014:Ssh2 UTSW 11 77455276 nonsense probably null
R5380:Ssh2 UTSW 11 77453945 missense probably benign 0.01
R5574:Ssh2 UTSW 11 77450115 missense probably benign
R5593:Ssh2 UTSW 11 77421366 missense probably damaging 0.99
R5739:Ssh2 UTSW 11 77449813 missense probably damaging 1.00
R6180:Ssh2 UTSW 11 77453465 missense probably benign 0.43
R6542:Ssh2 UTSW 11 77450150 missense possibly damaging 0.94
R6713:Ssh2 UTSW 11 77449433 missense possibly damaging 0.89
R7108:Ssh2 UTSW 11 77454794 missense probably benign
R7255:Ssh2 UTSW 11 77425593 missense probably damaging 1.00
R7332:Ssh2 UTSW 11 77453523 missense possibly damaging 0.48
R7362:Ssh2 UTSW 11 77449650 missense probably benign 0.01
R7395:Ssh2 UTSW 11 77393073 missense probably damaging 0.99
R7412:Ssh2 UTSW 11 77450108 missense probably damaging 0.98
R7493:Ssh2 UTSW 11 77437716 missense probably benign 0.16
R7686:Ssh2 UTSW 11 77425324 missense possibly damaging 0.89
R7870:Ssh2 UTSW 11 77453615 missense probably benign
R7895:Ssh2 UTSW 11 77454626 missense probably benign 0.41
R7963:Ssh2 UTSW 11 77421356 missense possibly damaging 0.93
R8030:Ssh2 UTSW 11 77454506 missense probably benign 0.01
R8065:Ssh2 UTSW 11 77441985 missense probably damaging 1.00
R8099:Ssh2 UTSW 11 77454929 nonsense probably null
R8294:Ssh2 UTSW 11 77454201 missense probably benign 0.08
R8464:Ssh2 UTSW 11 77454253 nonsense probably null
R8469:Ssh2 UTSW 11 77449608 missense probably benign 0.41
R8547:Ssh2 UTSW 11 77449707 missense probably benign 0.10
R8677:Ssh2 UTSW 11 77455193 missense possibly damaging 0.77
R8758:Ssh2 UTSW 11 77454017 missense probably benign
RF018:Ssh2 UTSW 11 77454054 missense probably damaging 0.99
X0017:Ssh2 UTSW 11 77441898 missense probably damaging 1.00
Z1088:Ssh2 UTSW 11 77449495 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGACTGCCTAGGGTCAGATAG -3'
(R):5'- TTGTCTTGCGGGCTACTTAAC -3'

Sequencing Primer
(F):5'- CTGCCTAGGGTCAGATAGTAGAAG -3'
(R):5'- CTTGCGGGCTACTTAACATAGG -3'
Posted On2019-05-15