Incidental Mutation 'R0599:Ap3m2'
ID 55224
Institutional Source Beutler Lab
Gene Symbol Ap3m2
Ensembl Gene ENSMUSG00000031539
Gene Name adaptor-related protein complex 3, mu 2 subunit
Synonyms AP-3B, 5830445E16Rik
MMRRC Submission 038788-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0599 (G1)
Quality Score 195
Status Validated
Chromosome 8
Chromosomal Location 22787354-22805622 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 22793112 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Aspartic acid at position 208 (A208D)
Ref Sequence ENSEMBL: ENSMUSP00000147967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163739] [ENSMUST00000210656]
AlphaFold Q8R2R9
Predicted Effect possibly damaging
Transcript: ENSMUST00000163739
AA Change: A208D

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128446
Gene: ENSMUSG00000031539
AA Change: A208D

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 137 2.7e-8 PFAM
Pfam:Adap_comp_sub 165 418 1.3e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210148
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210476
Predicted Effect possibly damaging
Transcript: ENSMUST00000210656
AA Change: A208D

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.7068 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the heterotetrameric adaptor-related protein comlex 3 (AP-3), which belongs to the adaptor complexes medium subunits family. The AP-3 complex plays a role in protein trafficking to lysosomes and specialized organelles. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygous null mice suffer from spontaneous recurrent epileptic seizures, are more susceptible to drug-induced seizures and show impaired GABA release, fewer synaptic vesicles, enhanced long-term potentiation, and abnormal propagation of neuronal excitability via the temporoammonic pathway. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,552,245 L978P probably damaging Het
Abcb1a C T 5: 8,698,539 T290M probably benign Het
Abcd3 A T 3: 121,765,093 F585I probably damaging Het
Acan A G 7: 79,111,290 probably benign Het
Anxa6 T C 11: 54,979,466 D667G possibly damaging Het
Arhgap17 A T 7: 123,303,790 probably benign Het
Bptf A G 11: 107,068,382 V1838A probably damaging Het
Brip1 T A 11: 86,152,737 M334L probably benign Het
Btbd10 C T 7: 113,335,309 probably benign Het
Btbd11 G A 10: 85,658,336 G1106D probably damaging Het
Cdh7 C A 1: 110,052,966 T208K probably damaging Het
Cnga4 A G 7: 105,405,818 Y100C probably damaging Het
Dnah10 G A 5: 124,800,953 V2644M probably damaging Het
Dnah9 T C 11: 65,965,689 D2882G probably damaging Het
Eapp T A 12: 54,685,962 K117M probably damaging Het
Eml3 T C 19: 8,939,063 V673A probably benign Het
Ephb4 G A 5: 137,369,855 C754Y probably damaging Het
Eps8l1 A G 7: 4,477,957 D33G possibly damaging Het
Farsa A G 8: 84,867,583 K321E probably damaging Het
Fry G A 5: 150,437,159 R2090Q probably damaging Het
Gm10283 A G 8: 60,501,224 probably benign Het
Grm4 A G 17: 27,431,490 I844T probably benign Het
Gtf2h3 A G 5: 124,588,628 D124G probably benign Het
Gulo A T 14: 65,990,441 D347E probably damaging Het
Hmcn1 A G 1: 150,609,801 F4350S possibly damaging Het
Hspg2 A G 4: 137,512,401 D473G probably damaging Het
Il17ra T A 6: 120,481,505 I539N probably damaging Het
Insrr A G 3: 87,813,133 E1026G probably damaging Het
Itga2 A T 13: 114,856,650 probably benign Het
Kdm1b A T 13: 47,058,810 D190V possibly damaging Het
Lima1 A T 15: 99,802,159 N146K probably damaging Het
Mettl7a3 A T 15: 100,335,383 N152Y possibly damaging Het
Mnt G T 11: 74,842,296 V85L probably benign Het
Mon2 T A 10: 123,026,065 probably benign Het
Mtf1 T C 4: 124,820,201 probably benign Het
Mylk4 T C 13: 32,712,754 probably null Het
Myo18b A C 5: 112,865,750 L780R probably damaging Het
Myo1e A G 9: 70,376,660 probably benign Het
Obscn A G 11: 59,073,696 S705P probably damaging Het
Ocrl A T X: 47,936,086 probably benign Het
Olfr1260 T C 2: 89,978,201 F141S probably benign Het
Olfr394 A T 11: 73,887,904 M156K probably benign Het
Olfr599 A G 7: 103,338,186 N44S probably damaging Het
Olfr639 A T 7: 104,012,188 C171* probably null Het
Otof T A 5: 30,370,705 K1931N probably damaging Het
Plcxd3 A G 15: 4,516,867 S118G probably damaging Het
Plcz1 T A 6: 140,028,542 Q58L probably benign Het
Proser1 C A 3: 53,479,064 P789Q probably benign Het
Rassf4 T C 6: 116,645,936 E38G probably damaging Het
Ros1 A T 10: 52,123,300 Y1164N probably damaging Het
Rpgrip1l A G 8: 91,305,000 I83T probably damaging Het
Scn9a T G 2: 66,526,799 K1053Q probably damaging Het
Sgsm1 G T 5: 113,245,028 Q1087K probably damaging Het
Slc16a10 T C 10: 40,141,918 D40G probably benign Het
Slc27a6 A G 18: 58,556,813 D117G probably damaging Het
Slc2a9 T A 5: 38,480,144 probably benign Het
Slc4a1 A G 11: 102,357,915 probably benign Het
Smarca1 T A X: 47,823,426 Q982L probably benign Het
Sp100 T A 1: 85,681,110 I320N possibly damaging Het
Stx8 A T 11: 68,109,362 R209S probably null Het
Sulf2 T C 2: 166,083,879 T453A possibly damaging Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tenm2 T A 11: 36,024,780 I1976F possibly damaging Het
Tenm3 G A 8: 48,277,710 S1341L probably damaging Het
Tmem130 C T 5: 144,737,809 V369M probably damaging Het
Tmem200c A G 17: 68,840,511 K30E probably damaging Het
Tmem225 A G 9: 40,149,747 I117V possibly damaging Het
Top2a A G 11: 99,001,417 I1073T probably damaging Het
Trps1 A C 15: 50,831,860 Y296* probably null Het
Tubg1 T C 11: 101,125,336 M377T probably benign Het
Vmn1r35 G A 6: 66,679,513 H58Y probably benign Het
Vmn1r56 G A 7: 5,196,430 H63Y probably benign Het
Vmn1r75 T C 7: 11,881,262 probably null Het
Vnn3 T C 10: 23,865,705 S303P possibly damaging Het
Wdr49 C T 3: 75,431,076 probably null Het
Wdr49 T C 3: 75,449,890 probably null Het
Zcchc6 A G 13: 59,809,487 V7A probably damaging Het
Zzef1 T C 11: 72,913,178 L2582P probably damaging Het
Other mutations in Ap3m2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Ap3m2 APN 8 22797227 splice site probably null
IGL01288:Ap3m2 APN 8 22803915 missense probably benign
IGL01391:Ap3m2 APN 8 22799647 missense probably benign 0.00
R1566:Ap3m2 UTSW 8 22803951 missense probably damaging 1.00
R1576:Ap3m2 UTSW 8 22808467 unclassified probably benign
R2917:Ap3m2 UTSW 8 22799799 missense probably benign 0.00
R4884:Ap3m2 UTSW 8 22803981 missense probably damaging 1.00
R4995:Ap3m2 UTSW 8 22803776 missense probably benign 0.19
R5100:Ap3m2 UTSW 8 22789388 missense probably benign
R5738:Ap3m2 UTSW 8 22803861 missense possibly damaging 0.52
R7030:Ap3m2 UTSW 8 22799791 missense probably damaging 0.99
R7378:Ap3m2 UTSW 8 22804010 missense probably benign 0.31
R7602:Ap3m2 UTSW 8 22792754 missense probably benign 0.00
R7732:Ap3m2 UTSW 8 22797089 missense probably benign 0.00
R7866:Ap3m2 UTSW 8 22799658 missense probably benign 0.02
R8288:Ap3m2 UTSW 8 22793137 missense probably benign 0.03
R9181:Ap3m2 UTSW 8 22799758 missense probably damaging 1.00
R9358:Ap3m2 UTSW 8 22790943 missense possibly damaging 0.53
Z1177:Ap3m2 UTSW 8 22791321 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CCTTTGAGAAGCAACGCAGGTGAC -3'
(R):5'- GCACTCCATGATGGACAGATGGATG -3'

Sequencing Primer
(F):5'- GCAGGTGACACTTTCACTAAG -3'
(R):5'- ggaggaagggaggaagagag -3'
Posted On 2013-07-11