Incidental Mutation 'R7125:Scn2a'
ID 552251
Institutional Source Beutler Lab
Gene Symbol Scn2a
Ensembl Gene ENSMUSG00000075318
Gene Name sodium channel, voltage-gated, type II, alpha
Synonyms A230052E19Rik, Nav1.2, Scn2a1
MMRRC Submission 045327-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7125 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 65451115-65597791 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 65594277 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 1709 (F1709L)
Ref Sequence ENSEMBL: ENSMUSP00000028377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028377] [ENSMUST00000100067] [ENSMUST00000200829]
AlphaFold B1AWN6
Predicted Effect probably damaging
Transcript: ENSMUST00000028377
AA Change: F1709L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028377
Gene: ENSMUSG00000075318
AA Change: F1709L

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 2.2e-81 PFAM
low complexity region 450 471 N/A INTRINSIC
Pfam:Na_trans_cytopl 505 710 9.6e-83 PFAM
Pfam:Ion_trans 759 994 3.6e-57 PFAM
Pfam:Na_trans_assoc 998 1204 1.7e-63 PFAM
Pfam:Ion_trans 1208 1484 3.3e-66 PFAM
Pfam:Ion_trans 1531 1788 2.8e-57 PFAM
Pfam:PKD_channel 1627 1782 8.6e-7 PFAM
IQ 1905 1927 3.59e-3 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100067
AA Change: F1709L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097645
Gene: ENSMUSG00000075318
AA Change: F1709L

DomainStartEndE-ValueType
Pfam:Ion_trans 157 424 3.3e-75 PFAM
low complexity region 433 448 N/A INTRINSIC
low complexity region 450 471 N/A INTRINSIC
Pfam:DUF3451 488 711 2.6e-66 PFAM
Pfam:Ion_trans 794 983 1.1e-47 PFAM
Pfam:Na_trans_assoc 998 1219 3.5e-77 PFAM
Pfam:Ion_trans 1245 1473 4.4e-55 PFAM
PDB:1BYY|A 1475 1527 3e-31 PDB
Pfam:Ion_trans 1566 1776 2.4e-52 PFAM
Pfam:PKD_channel 1628 1783 3.6e-7 PFAM
IQ 1905 1927 3.59e-3 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200829
AA Change: F1709L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143882
Gene: ENSMUSG00000075318
AA Change: F1709L

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 1.2e-79 PFAM
low complexity region 450 471 N/A INTRINSIC
Pfam:Na_trans_cytopl 505 710 7.1e-80 PFAM
Pfam:Ion_trans 759 994 2.1e-55 PFAM
Pfam:Na_trans_assoc 998 1204 8e-61 PFAM
Pfam:Ion_trans 1208 1484 1.9e-64 PFAM
Pfam:Ion_trans 1531 1788 1.6e-55 PFAM
Pfam:PKD_channel 1627 1782 1.2e-4 PFAM
IQ 1905 1927 1.8e-5 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with four repeat domains, each of which is composed of six membrane-spanning segments, and one or more regulatory beta subunits. Voltage-gated sodium channels are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. In humans, variants of this gene are associated with seizure disorders and autism spectrum disorder. Mice homozygous for a knockout mutation die with severe hypoxia and extensive neuronal cell death, while gain of function mutations result in progressive seizure disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygotes for a targeted mutation exhibit excess neuronal apoptosis (especially in the brainstem), reduced neuronal sodium channel currents in vitro, and severe hypoxia resulting in neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik A T 11: 80,255,751 (GRCm39) C296S probably damaging Het
Ago3 T C 4: 126,264,145 (GRCm39) I354V probably null Het
Aldh1l1 G A 6: 90,553,761 (GRCm39) probably null Het
Ankrd49 TAA TA 9: 14,693,836 (GRCm39) probably null Het
B3gnt7 A G 1: 86,233,099 (GRCm39) Y115C probably damaging Het
Cacna1h A T 17: 25,602,510 (GRCm39) M1506K probably damaging Het
Cars1 T C 7: 143,138,510 (GRCm39) T226A probably benign Het
Ccdc28b T A 4: 129,514,885 (GRCm39) T75S probably benign Het
Cdc42bpg A G 19: 6,372,321 (GRCm39) I1436V probably damaging Het
Cep152 A T 2: 125,408,593 (GRCm39) Y1320* probably null Het
Cntnap2 A T 6: 46,965,580 (GRCm39) Y797F probably benign Het
Coq8a T A 1: 179,996,366 (GRCm39) N490I probably damaging Het
Csmd2 T C 4: 128,389,955 (GRCm39) L2230P Het
Cyp4a14 A T 4: 115,348,358 (GRCm39) I373N probably damaging Het
Ddx1 A G 12: 13,293,864 (GRCm39) S86P probably benign Het
Dennd3 A T 15: 73,405,140 (GRCm39) I298F possibly damaging Het
Disp1 C A 1: 182,869,030 (GRCm39) R1130L probably damaging Het
Dnah2 T C 11: 69,327,008 (GRCm39) T3533A probably damaging Het
Fam53b T C 7: 132,373,357 (GRCm39) H27R probably damaging Het
Firrm T C 1: 163,789,631 (GRCm39) T635A probably benign Het
Fyb1 G A 15: 6,674,337 (GRCm39) E658K possibly damaging Het
Gapvd1 T C 2: 34,585,612 (GRCm39) S996G probably benign Het
Gm47959 G A 1: 82,978,503 (GRCm39) G57S unknown Het
Golgb1 T A 16: 36,738,325 (GRCm39) H2262Q possibly damaging Het
Gpam T C 19: 55,064,767 (GRCm39) T646A probably benign Het
Gpt2 G A 8: 86,244,681 (GRCm39) E325K probably benign Het
Hexd C T 11: 121,095,496 (GRCm39) probably benign Het
Micu2 A T 14: 58,209,238 (GRCm39) Y73* probably null Het
N4bp2l2 T C 5: 150,573,894 (GRCm39) probably null Het
Or11h7 T C 14: 50,891,041 (GRCm39) C116R possibly damaging Het
Or1e31 T C 11: 73,689,990 (GRCm39) M198V probably benign Het
Or1m1 A T 9: 18,666,174 (GRCm39) Y252* probably null Het
Or51t4 T C 7: 102,598,386 (GRCm39) V238A probably damaging Het
Or5b112 A T 19: 13,319,103 (GRCm39) probably null Het
P3r3urf A G 4: 116,030,667 (GRCm39) M24V probably benign Het
Prkca A G 11: 107,874,848 (GRCm39) Y365H probably damaging Het
Ptpre C T 7: 135,255,744 (GRCm39) R155* probably null Het
Ryr2 T A 13: 11,684,873 (GRCm39) N3023Y probably damaging Het
S100a7a A G 3: 90,562,822 (GRCm39) D3G probably benign Het
Slc15a2 T C 16: 36,602,660 (GRCm39) E67G probably damaging Het
Slc25a22 A G 7: 141,011,655 (GRCm39) L195P probably damaging Het
Sp140 TTTTTTTTTTTTT TTTTTTTTTTTTTTTTTT 1: 85,572,290 (GRCm39) probably benign Het
Stim1 T A 7: 102,084,741 (GRCm39) H564Q possibly damaging Het
Sulf2 C T 2: 165,917,448 (GRCm39) W855* probably null Het
Tenm3 T C 8: 49,127,588 (GRCm39) N30S probably benign Het
Trim59 T C 3: 68,944,197 (GRCm39) D381G probably benign Het
Ttc21b T C 2: 66,066,670 (GRCm39) T328A probably benign Het
Ttc6 C G 12: 57,623,125 (GRCm39) Q175E probably benign Het
Vmn2r44 T C 7: 8,370,941 (GRCm39) I702V probably damaging Het
Zfp768 A T 7: 126,943,959 (GRCm39) F59L probably damaging Het
Other mutations in Scn2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Scn2a APN 2 65,594,784 (GRCm39) missense probably benign
IGL00159:Scn2a APN 2 65,573,434 (GRCm39) missense probably damaging 1.00
IGL00418:Scn2a APN 2 65,594,866 (GRCm39) missense probably benign 0.43
IGL00753:Scn2a APN 2 65,514,207 (GRCm39) missense possibly damaging 0.66
IGL00770:Scn2a APN 2 65,566,197 (GRCm39) missense probably damaging 1.00
IGL00774:Scn2a APN 2 65,566,197 (GRCm39) missense probably damaging 1.00
IGL00847:Scn2a APN 2 65,501,078 (GRCm39) missense probably damaging 1.00
IGL01155:Scn2a APN 2 65,548,092 (GRCm39) missense probably damaging 1.00
IGL01329:Scn2a APN 2 65,547,852 (GRCm39) missense probably benign 0.05
IGL01537:Scn2a APN 2 65,546,219 (GRCm39) missense probably benign 0.00
IGL01672:Scn2a APN 2 65,582,278 (GRCm39) missense probably damaging 1.00
IGL01958:Scn2a APN 2 65,532,173 (GRCm39) missense probably damaging 1.00
IGL02028:Scn2a APN 2 65,594,002 (GRCm39) missense probably damaging 0.96
IGL02142:Scn2a APN 2 65,546,182 (GRCm39) missense probably damaging 1.00
IGL02160:Scn2a APN 2 65,560,460 (GRCm39) missense probably damaging 1.00
IGL02183:Scn2a APN 2 65,501,947 (GRCm39) missense probably benign 0.20
IGL02341:Scn2a APN 2 65,518,721 (GRCm39) missense probably damaging 1.00
IGL02504:Scn2a APN 2 65,514,228 (GRCm39) missense probably benign 0.02
IGL02530:Scn2a APN 2 65,560,522 (GRCm39) missense probably damaging 0.99
IGL02621:Scn2a APN 2 65,579,223 (GRCm39) splice site probably benign
IGL02652:Scn2a APN 2 65,532,382 (GRCm39) missense possibly damaging 0.82
IGL02966:Scn2a APN 2 65,532,188 (GRCm39) missense possibly damaging 0.93
IGL03188:Scn2a APN 2 65,501,997 (GRCm39) missense probably damaging 0.99
IGL03329:Scn2a APN 2 65,594,973 (GRCm39) missense probably benign
IGL03336:Scn2a APN 2 65,519,088 (GRCm39) missense probably damaging 1.00
IGL03391:Scn2a APN 2 65,594,557 (GRCm39) missense probably damaging 1.00
PIT4280001:Scn2a UTSW 2 65,546,074 (GRCm39) missense probably damaging 1.00
PIT4362001:Scn2a UTSW 2 65,514,182 (GRCm39) missense probably benign 0.09
PIT4403001:Scn2a UTSW 2 65,542,252 (GRCm39) missense probably damaging 1.00
PIT4520001:Scn2a UTSW 2 65,518,763 (GRCm39) missense probably damaging 1.00
R0021:Scn2a UTSW 2 65,500,859 (GRCm39) missense possibly damaging 0.51
R0141:Scn2a UTSW 2 65,542,160 (GRCm39) missense probably benign 0.01
R0240:Scn2a UTSW 2 65,566,118 (GRCm39) missense probably benign 0.32
R0240:Scn2a UTSW 2 65,566,118 (GRCm39) missense probably benign 0.32
R0335:Scn2a UTSW 2 65,512,435 (GRCm39) missense probably damaging 1.00
R0508:Scn2a UTSW 2 65,548,186 (GRCm39) missense probably damaging 0.99
R0558:Scn2a UTSW 2 65,542,269 (GRCm39) missense probably benign 0.26
R0600:Scn2a UTSW 2 65,532,177 (GRCm39) missense possibly damaging 0.90
R0667:Scn2a UTSW 2 65,582,340 (GRCm39) missense possibly damaging 0.91
R1178:Scn2a UTSW 2 65,517,123 (GRCm39) splice site probably benign
R1244:Scn2a UTSW 2 65,593,999 (GRCm39) missense probably damaging 0.98
R1386:Scn2a UTSW 2 65,519,085 (GRCm39) missense probably damaging 1.00
R1434:Scn2a UTSW 2 65,532,335 (GRCm39) missense possibly damaging 0.79
R1440:Scn2a UTSW 2 65,594,938 (GRCm39) missense probably benign
R1448:Scn2a UTSW 2 65,514,189 (GRCm39) missense probably benign 0.17
R1460:Scn2a UTSW 2 65,532,187 (GRCm39) missense probably damaging 0.96
R1553:Scn2a UTSW 2 65,544,180 (GRCm39) nonsense probably null
R1642:Scn2a UTSW 2 65,514,041 (GRCm39) missense probably damaging 1.00
R1803:Scn2a UTSW 2 65,501,111 (GRCm39) splice site probably null
R1981:Scn2a UTSW 2 65,520,514 (GRCm39) missense probably damaging 1.00
R2002:Scn2a UTSW 2 65,512,427 (GRCm39) missense probably null 1.00
R2068:Scn2a UTSW 2 65,582,417 (GRCm39) missense probably benign 0.14
R2125:Scn2a UTSW 2 65,582,423 (GRCm39) nonsense probably null
R2126:Scn2a UTSW 2 65,582,423 (GRCm39) nonsense probably null
R2876:Scn2a UTSW 2 65,546,241 (GRCm39) missense possibly damaging 0.64
R2878:Scn2a UTSW 2 65,518,715 (GRCm39) missense probably damaging 1.00
R3113:Scn2a UTSW 2 65,579,129 (GRCm39) missense possibly damaging 0.86
R3749:Scn2a UTSW 2 65,544,115 (GRCm39) missense probably damaging 1.00
R3750:Scn2a UTSW 2 65,544,115 (GRCm39) missense probably damaging 1.00
R3765:Scn2a UTSW 2 65,513,054 (GRCm39) missense possibly damaging 0.51
R3850:Scn2a UTSW 2 65,512,375 (GRCm39) missense probably benign 0.14
R4585:Scn2a UTSW 2 65,573,395 (GRCm39) splice site probably null
R4586:Scn2a UTSW 2 65,573,395 (GRCm39) splice site probably null
R4588:Scn2a UTSW 2 65,544,111 (GRCm39) missense possibly damaging 0.76
R4622:Scn2a UTSW 2 65,582,371 (GRCm39) missense probably benign 0.04
R5108:Scn2a UTSW 2 65,518,974 (GRCm39) missense probably damaging 1.00
R5161:Scn2a UTSW 2 65,594,935 (GRCm39) missense probably benign 0.00
R5235:Scn2a UTSW 2 65,582,355 (GRCm39) missense probably damaging 1.00
R5464:Scn2a UTSW 2 65,532,100 (GRCm39) missense probably damaging 1.00
R5586:Scn2a UTSW 2 65,537,639 (GRCm39) nonsense probably null
R5630:Scn2a UTSW 2 65,556,709 (GRCm39) missense probably damaging 1.00
R5715:Scn2a UTSW 2 65,547,928 (GRCm39) missense probably benign 0.27
R5730:Scn2a UTSW 2 65,512,882 (GRCm39) nonsense probably null
R5734:Scn2a UTSW 2 65,548,066 (GRCm39) missense possibly damaging 0.49
R5779:Scn2a UTSW 2 65,594,827 (GRCm39) missense probably benign 0.00
R6133:Scn2a UTSW 2 65,573,448 (GRCm39) missense probably benign 0.35
R6547:Scn2a UTSW 2 65,546,241 (GRCm39) missense probably benign 0.29
R6549:Scn2a UTSW 2 65,595,018 (GRCm39) missense probably benign 0.05
R6818:Scn2a UTSW 2 65,519,013 (GRCm39) nonsense probably null
R6999:Scn2a UTSW 2 65,512,453 (GRCm39) missense probably benign
R7069:Scn2a UTSW 2 65,594,950 (GRCm39) missense probably benign 0.00
R7073:Scn2a UTSW 2 65,558,787 (GRCm39) missense probably benign 0.00
R7178:Scn2a UTSW 2 65,579,197 (GRCm39) nonsense probably null
R7179:Scn2a UTSW 2 65,532,323 (GRCm39) missense probably damaging 1.00
R7203:Scn2a UTSW 2 65,578,663 (GRCm39) missense probably benign 0.01
R7227:Scn2a UTSW 2 65,582,367 (GRCm39) missense probably damaging 0.98
R7269:Scn2a UTSW 2 65,594,113 (GRCm39) missense probably damaging 1.00
R7358:Scn2a UTSW 2 65,512,850 (GRCm39) nonsense probably null
R7388:Scn2a UTSW 2 65,518,998 (GRCm39) missense probably damaging 1.00
R7491:Scn2a UTSW 2 65,532,352 (GRCm39) missense probably damaging 0.99
R7619:Scn2a UTSW 2 65,546,247 (GRCm39) missense probably damaging 1.00
R7695:Scn2a UTSW 2 65,542,251 (GRCm39) missense probably damaging 0.99
R7735:Scn2a UTSW 2 65,594,013 (GRCm39) missense probably benign 0.40
R7911:Scn2a UTSW 2 65,512,427 (GRCm39) missense probably null 1.00
R8096:Scn2a UTSW 2 65,594,366 (GRCm39) missense probably damaging 0.98
R8172:Scn2a UTSW 2 65,520,672 (GRCm39) missense probably benign 0.01
R8220:Scn2a UTSW 2 65,520,620 (GRCm39) missense probably benign 0.01
R8333:Scn2a UTSW 2 65,514,191 (GRCm39) missense probably benign 0.01
R8416:Scn2a UTSW 2 65,511,345 (GRCm39) missense probably benign 0.00
R8850:Scn2a UTSW 2 65,518,730 (GRCm39) missense probably damaging 1.00
R8897:Scn2a UTSW 2 65,546,002 (GRCm39) critical splice acceptor site probably null
R8977:Scn2a UTSW 2 65,594,014 (GRCm39) missense probably damaging 0.99
R8992:Scn2a UTSW 2 65,594,242 (GRCm39) missense probably damaging 1.00
R9190:Scn2a UTSW 2 65,511,346 (GRCm39) missense probably benign 0.00
R9206:Scn2a UTSW 2 65,548,131 (GRCm39) missense probably damaging 1.00
R9355:Scn2a UTSW 2 65,594,433 (GRCm39) missense probably damaging 1.00
R9452:Scn2a UTSW 2 65,595,163 (GRCm39) missense probably benign
R9529:Scn2a UTSW 2 65,594,932 (GRCm39) missense probably damaging 0.99
R9567:Scn2a UTSW 2 65,518,974 (GRCm39) missense probably damaging 1.00
R9569:Scn2a UTSW 2 65,560,622 (GRCm39) missense probably damaging 1.00
R9657:Scn2a UTSW 2 65,566,032 (GRCm39) missense probably damaging 1.00
R9715:Scn2a UTSW 2 65,579,149 (GRCm39) missense possibly damaging 0.93
R9761:Scn2a UTSW 2 65,566,030 (GRCm39) missense probably damaging 1.00
Z1176:Scn2a UTSW 2 65,582,212 (GRCm39) missense possibly damaging 0.84
Z1177:Scn2a UTSW 2 65,548,079 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- ATCCTACGCCTGATCAAAGG -3'
(R):5'- TGTTCACCACAACCAGGAAG -3'

Sequencing Primer
(F):5'- CCTGATCAAAGGCGCCAAGG -3'
(R):5'- TGTTCACCACAACCAGGAAGGATATG -3'
Posted On 2019-05-15