Incidental Mutation 'R7126:Klhl12'
ID552299
Institutional Source Beutler Lab
Gene Symbol Klhl12
Ensembl Gene ENSMUSG00000026455
Gene Namekelch-like 12
SynonymsC3ip1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7126 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location134455531-134491018 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 134467783 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 161 (H161R)
Ref Sequence ENSEMBL: ENSMUSP00000027725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027725] [ENSMUST00000112232] [ENSMUST00000116528]
Predicted Effect probably damaging
Transcript: ENSMUST00000027725
AA Change: H161R

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027725
Gene: ENSMUSG00000026455
AA Change: H161R

DomainStartEndE-ValueType
BTB 33 130 1.9e-30 SMART
BACK 135 237 5.39e-34 SMART
Kelch 282 329 1.9e-9 SMART
Kelch 330 379 3.18e-11 SMART
Kelch 380 426 1.85e-12 SMART
Kelch 427 473 3.11e-14 SMART
Kelch 474 520 1.74e-17 SMART
Kelch 521 567 4.71e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112232
AA Change: H161R

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107851
Gene: ENSMUSG00000026455
AA Change: H161R

DomainStartEndE-ValueType
BTB 33 130 1.9e-30 SMART
BACK 135 237 5.39e-34 SMART
Kelch 282 329 1.9e-9 SMART
Kelch 330 379 3.18e-11 SMART
Kelch 380 426 1.85e-12 SMART
Kelch 427 493 3.39e-6 SMART
Kelch 494 540 4.71e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000116528
AA Change: H161R

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112227
Gene: ENSMUSG00000026455
AA Change: H161R

DomainStartEndE-ValueType
BTB 33 130 1.9e-30 SMART
BACK 135 237 5.39e-34 SMART
Kelch 282 329 1.9e-9 SMART
Kelch 330 379 3.18e-11 SMART
Kelch 380 426 1.85e-12 SMART
Kelch 427 473 3.11e-14 SMART
Kelch 474 520 1.74e-17 SMART
Kelch 521 567 4.71e-14 SMART
Meta Mutation Damage Score 0.5874 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the KLHL (Kelch-like) family of proteins. This protein has been identified as an autoantigen in the autoimmune disease Sjogren's syndrome and as a potential biomarker in primary biliary cirrhosis. This protein may act as a substrate adaptor of the Cullin-3 ubiquitin ligase complex to promote substrate-specific ubiquitylation. Ubiquitylation by this complex has been shown to regulate the Wnt signaling pathway as well as COPII vesicle coat size. A pseudogene has been identified on chromosome 22. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik C T 17: 23,720,564 V8I probably benign Het
1810062G17Rik T C 3: 36,481,839 C85R unknown Het
3110082I17Rik G T 5: 139,361,250 H153Q unknown Het
Acadsb T C 7: 131,437,448 I316T probably benign Het
Acsbg2 A T 17: 56,846,633 N523K probably damaging Het
Ahnak C T 19: 9,002,359 P336S possibly damaging Het
Ankdd1b A G 13: 96,429,862 V277A possibly damaging Het
Aspm A G 1: 139,480,803 Y2476C probably benign Het
Atg13 G A 2: 91,680,420 R321W probably damaging Het
B4galt2 A G 4: 117,877,538 F211S probably damaging Het
Baiap3 T A 17: 25,245,145 T913S possibly damaging Het
Btbd18 A T 2: 84,666,202 E61D possibly damaging Het
Btnl9 G T 11: 49,169,255 S555R probably damaging Het
Cbs T A 17: 31,619,139 M379L probably benign Het
Chd9 G A 8: 91,015,225 G1614D unknown Het
Cmya5 G A 13: 93,089,940 P2880L probably benign Het
Cnnm1 T C 19: 43,484,853 S729P probably damaging Het
Cox16 T A 12: 81,472,166 E70D probably benign Het
Cp A G 3: 19,980,624 H699R probably damaging Het
Cyp2d26 T C 15: 82,794,008 N56D probably benign Het
Dennd4c A G 4: 86,807,430 Y707C probably damaging Het
Dgcr14 T C 16: 17,911,290 T6A unknown Het
Dnah5 A T 15: 28,349,837 E2555D probably benign Het
Fam129a T A 1: 151,714,567 C537* probably null Het
Filip1 A G 9: 79,898,295 L59P possibly damaging Het
Fsip2 A G 2: 82,983,141 N3268S possibly damaging Het
Gja10 A T 4: 32,601,014 C457S probably benign Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 101,794,171 probably benign Het
Gm47959 G A 1: 83,000,782 G57S unknown Het
Gm4869 A T 5: 140,491,318 D874V probably benign Het
Grid2 T A 6: 64,076,810 V331E probably damaging Het
Inpp4a C A 1: 37,374,272 H123Q probably benign Het
Ireb2 T A 9: 54,886,567 Y260* probably null Het
Itpr2 G A 6: 146,357,796 Q628* probably null Het
Kbtbd11 G A 8: 15,028,759 A453T probably damaging Het
Kcnj2 A G 11: 111,072,822 T347A probably damaging Het
Krt78 T C 15: 101,948,436 E412G probably damaging Het
Lzic A G 4: 149,488,675 I95V probably damaging Het
Mme C T 3: 63,368,901 P700S probably damaging Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Mthfd2 A G 6: 83,313,490 V53A probably benign Het
Mtus1 A G 8: 41,015,402 L210P probably damaging Het
Muc16 T C 9: 18,641,216 T4594A probably benign Het
Olfm5 A T 7: 104,159,980 C208S probably damaging Het
Olfr1355 T C 10: 78,879,577 V135A possibly damaging Het
Olfr1368 A T 13: 21,142,718 L113H probably damaging Het
Olfr1494 T A 19: 13,749,523 I139N possibly damaging Het
Parp12 T C 6: 39,111,736 I189V probably benign Het
Plin1 T C 7: 79,726,664 probably null Het
Prl7a1 C T 13: 27,642,419 probably null Het
Ptpn23 T C 9: 110,388,744 D711G probably benign Het
Rgs22 A T 15: 36,103,808 I169N probably damaging Het
Scn7a G T 2: 66,757,286 H24Q possibly damaging Het
Scrt2 C T 2: 152,093,086 P53L probably damaging Het
Sh3rf1 A T 8: 61,349,424 I264L probably benign Het
Smarcd1 A T 15: 99,709,325 D393V probably damaging Het
Spag17 T G 3: 100,101,435 N1960K probably benign Het
Ssb A G 2: 69,866,501 T62A possibly damaging Het
Taar7b T A 10: 24,000,062 Y42N possibly damaging Het
Terf1 A T 1: 15,813,139 I159L probably benign Het
Tff3 T G 17: 31,127,436 N54T probably benign Het
Top2a A G 11: 99,014,992 L285P probably benign Het
Trim24 A G 6: 37,919,457 Y283C probably damaging Het
Trim58 T C 11: 58,640,579 C38R probably damaging Het
Trpa1 T A 1: 14,890,424 T647S probably benign Het
Trpm4 A T 7: 45,310,709 probably null Het
Trpm6 C T 19: 18,854,033 Q1421* probably null Het
Ubr2 A T 17: 46,974,056 probably null Het
Vmn1r46 T G 6: 89,976,994 I275S possibly damaging Het
Vmn2r54 A G 7: 12,632,161 F282S possibly damaging Het
Vmn2r57 A G 7: 41,399,794 S844P possibly damaging Het
Vps13a A C 19: 16,710,879 C855G probably benign Het
Wdr31 T A 4: 62,463,429 Q55L probably benign Het
Other mutations in Klhl12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Klhl12 APN 1 134483753 missense probably benign
IGL01834:Klhl12 APN 1 134489420 missense probably damaging 1.00
IGL01947:Klhl12 APN 1 134463951 missense probably damaging 1.00
IGL02005:Klhl12 APN 1 134463914 missense possibly damaging 0.91
IGL02550:Klhl12 APN 1 134467705 missense possibly damaging 0.94
R0403:Klhl12 UTSW 1 134485856 missense possibly damaging 0.82
R1508:Klhl12 UTSW 1 134488974 missense possibly damaging 0.58
R1801:Klhl12 UTSW 1 134489070 missense probably damaging 1.00
R4384:Klhl12 UTSW 1 134487654 missense probably damaging 1.00
R4569:Klhl12 UTSW 1 134485769 missense probably benign 0.23
R5302:Klhl12 UTSW 1 134489451 missense possibly damaging 0.63
R5503:Klhl12 UTSW 1 134485915 critical splice donor site probably null
R5877:Klhl12 UTSW 1 134483820 nonsense probably null
R6918:Klhl12 UTSW 1 134475846 missense possibly damaging 0.46
R7688:Klhl12 UTSW 1 134489030 missense probably benign 0.01
R7897:Klhl12 UTSW 1 134458481 missense probably benign 0.00
R7898:Klhl12 UTSW 1 134458481 missense probably benign 0.00
R7980:Klhl12 UTSW 1 134458481 missense probably benign 0.00
R7981:Klhl12 UTSW 1 134458481 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCTTAGGTCTGCTCACTGC -3'
(R):5'- ATGACCAGGGCAGATTTTCTTC -3'

Sequencing Primer
(F):5'- CACTGCCTGTGTGTGTCCTAG -3'
(R):5'- AGGGCAGATTTTCTTCTCCATAGAC -3'
Posted On2019-05-15