Mutagenetix > Incidental Mutations

Incidental Mutation 'R0599:Myo1e'

55230

Institutional Source

Beutler Lab

Gene Symbol

Myo1e

Ensembl Gene

ENSMUSG00000032220

Gene Name

myosin IE

Synonyms

2310020N23Rik, 9130023P14Rik

MMRRC Submission

038788-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0599 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70207350-70399766 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 70376660 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000150376 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034745] [ENSMUST00000214042]

AlphaFold

E9Q634

Predicted Effect

probably benign
Transcript: ENSMUST00000034745

SMART Domains

Protein: ENSMUSP00000034745
Gene: ENSMUSG00000032220

Domain	Start	End	E-Value	Type
MYSc	13	693	N/A	SMART
Pfam:Myosin_TH1	719	917	1e-55	PFAM
SH3	1053	1107	2.12e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000214042

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.5%
20x: 95.0%

Validation Efficiency

98% (80/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nonmuscle class I myosins which are a subgroup of the unconventional myosin protein family. The unconventional myosin proteins function as actin-based molecular motors. Class I myosins are characterized by a head (motor) domain, a regulatory domain and a either a short or long tail domain. Among the class I myosins, this protein is distinguished by a long tail domain that is involved in crosslinking actin filaments. This protein localizes to the cytoplasm and may be involved in intracellular movement and membrane trafficking. Mutations in this gene are the cause of focal segmental glomerulosclerosis-6. This gene has been referred to as myosin IC in the literature but is distinct from the myosin IC gene located on chromosome 17. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygotes for a gene trapped allele exhibit embryonic lethality, embryonic hemorrhaging and hematopoietic defects. Homozygotes for a knock-out allele show proteinuria, chronic renal injury, kidney inflammation, and defects in renal filtration and podocyte organization. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	A	G	6: 128,552,245	L978P	probably damaging	Het
Abcb1a	C	T	5: 8,698,539	T290M	probably benign	Het
Abcd3	A	T	3: 121,765,093	F585I	probably damaging	Het
Acan	A	G	7: 79,111,290		probably benign	Het
Anxa6	T	C	11: 54,979,466	D667G	possibly damaging	Het
Ap3m2	G	T	8: 22,793,112	A208D	possibly damaging	Het
Arhgap17	A	T	7: 123,303,790		probably benign	Het
Bptf	A	G	11: 107,068,382	V1838A	probably damaging	Het
Brip1	T	A	11: 86,152,737	M334L	probably benign	Het
Btbd10	C	T	7: 113,335,309		probably benign	Het
Btbd11	G	A	10: 85,658,336	G1106D	probably damaging	Het
Cdh7	C	A	1: 110,052,966	T208K	probably damaging	Het
Cnga4	A	G	7: 105,405,818	Y100C	probably damaging	Het
Dnah10	G	A	5: 124,800,953	V2644M	probably damaging	Het
Dnah9	T	C	11: 65,965,689	D2882G	probably damaging	Het
Eapp	T	A	12: 54,685,962	K117M	probably damaging	Het
Eml3	T	C	19: 8,939,063	V673A	probably benign	Het
Ephb4	G	A	5: 137,369,855	C754Y	probably damaging	Het
Eps8l1	A	G	7: 4,477,957	D33G	possibly damaging	Het
Farsa	A	G	8: 84,867,583	K321E	probably damaging	Het
Fry	G	A	5: 150,437,159	R2090Q	probably damaging	Het
Gm10283	A	G	8: 60,501,224		probably benign	Het
Grm4	A	G	17: 27,431,490	I844T	probably benign	Het
Gtf2h3	A	G	5: 124,588,628	D124G	probably benign	Het
Gulo	A	T	14: 65,990,441	D347E	probably damaging	Het
Hmcn1	A	G	1: 150,609,801	F4350S	possibly damaging	Het
Hspg2	A	G	4: 137,512,401	D473G	probably damaging	Het
Il17ra	T	A	6: 120,481,505	I539N	probably damaging	Het
Insrr	A	G	3: 87,813,133	E1026G	probably damaging	Het
Itga2	A	T	13: 114,856,650		probably benign	Het
Kdm1b	A	T	13: 47,058,810	D190V	possibly damaging	Het
Lima1	A	T	15: 99,802,159	N146K	probably damaging	Het
Mettl7a3	A	T	15: 100,335,383	N152Y	possibly damaging	Het
Mnt	G	T	11: 74,842,296	V85L	probably benign	Het
Mon2	T	A	10: 123,026,065		probably benign	Het
Mtf1	T	C	4: 124,820,201		probably benign	Het
Mylk4	T	C	13: 32,712,754		probably null	Het
Myo18b	A	C	5: 112,865,750	L780R	probably damaging	Het
Obscn	A	G	11: 59,073,696	S705P	probably damaging	Het
Ocrl	A	T	X: 47,936,086		probably benign	Het
Olfr1260	T	C	2: 89,978,201	F141S	probably benign	Het
Olfr394	A	T	11: 73,887,904	M156K	probably benign	Het
Olfr599	A	G	7: 103,338,186	N44S	probably damaging	Het
Olfr639	A	T	7: 104,012,188	C171*	probably null	Het
Otof	T	A	5: 30,370,705	K1931N	probably damaging	Het
Plcxd3	A	G	15: 4,516,867	S118G	probably damaging	Het
Plcz1	T	A	6: 140,028,542	Q58L	probably benign	Het
Proser1	C	A	3: 53,479,064	P789Q	probably benign	Het
Rassf4	T	C	6: 116,645,936	E38G	probably damaging	Het
Ros1	A	T	10: 52,123,300	Y1164N	probably damaging	Het
Rpgrip1l	A	G	8: 91,305,000	I83T	probably damaging	Het
Scn9a	T	G	2: 66,526,799	K1053Q	probably damaging	Het
Sgsm1	G	T	5: 113,245,028	Q1087K	probably damaging	Het
Slc16a10	T	C	10: 40,141,918	D40G	probably benign	Het
Slc27a6	A	G	18: 58,556,813	D117G	probably damaging	Het
Slc2a9	T	A	5: 38,480,144		probably benign	Het
Slc4a1	A	G	11: 102,357,915		probably benign	Het
Smarca1	T	A	X: 47,823,426	Q982L	probably benign	Het
Sp100	T	A	1: 85,681,110	I320N	possibly damaging	Het
Stx8	A	T	11: 68,109,362	R209S	probably null	Het
Sulf2	T	C	2: 166,083,879	T453A	possibly damaging	Het
Syne2	AGAGTGAG	AGAGTGAGTGAG	12: 76,097,960		probably null	Het
Tenm2	T	A	11: 36,024,780	I1976F	possibly damaging	Het
Tenm3	G	A	8: 48,277,710	S1341L	probably damaging	Het
Tmem130	C	T	5: 144,737,809	V369M	probably damaging	Het
Tmem200c	A	G	17: 68,840,511	K30E	probably damaging	Het
Tmem225	A	G	9: 40,149,747	I117V	possibly damaging	Het
Top2a	A	G	11: 99,001,417	I1073T	probably damaging	Het
Trps1	A	C	15: 50,831,860	Y296*	probably null	Het
Tubg1	T	C	11: 101,125,336	M377T	probably benign	Het
Vmn1r35	G	A	6: 66,679,513	H58Y	probably benign	Het
Vmn1r56	G	A	7: 5,196,430	H63Y	probably benign	Het
Vmn1r75	T	C	7: 11,881,262		probably null	Het
Vnn3	T	C	10: 23,865,705	S303P	possibly damaging	Het
Wdr49	C	T	3: 75,431,076		probably null	Het
Wdr49	T	C	3: 75,449,890		probably null	Het
Zcchc6	A	G	13: 59,809,487	V7A	probably damaging	Het
Zzef1	T	C	11: 72,913,178	L2582P	probably damaging	Het

Other mutations in Myo1e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00817:Myo1e	APN	9	70342148	missense	probably benign	0.01
IGL00833:Myo1e	APN	9	70338778	missense	probably damaging	0.99
IGL00973:Myo1e	APN	9	70338787	missense	probably damaging	1.00
IGL01011:Myo1e	APN	9	70316589	splice site	probably benign
IGL01401:Myo1e	APN	9	70327166	missense	probably damaging	0.97
IGL01402:Myo1e	APN	9	70337766	missense	probably benign	0.02
IGL01404:Myo1e	APN	9	70337766	missense	probably benign	0.02
IGL01613:Myo1e	APN	9	70341273	splice site	probably benign
IGL01738:Myo1e	APN	9	70359370	missense	probably damaging	1.00
IGL01819:Myo1e	APN	9	70343040	splice site	probably benign
IGL02233:Myo1e	APN	9	70383799	splice site	probably benign
IGL02244:Myo1e	APN	9	70367689	missense	probably benign	0.00
IGL02440:Myo1e	APN	9	70346740	missense	probably damaging	1.00
IGL02806:Myo1e	APN	9	70362270	missense	probably benign	0.01
IGL02886:Myo1e	APN	9	70368773	missense	probably benign	0.00
IGL03178:Myo1e	APN	9	70286949	missense	possibly damaging	0.47
I2288:Myo1e	UTSW	9	70342097	missense	possibly damaging	0.80
R0036:Myo1e	UTSW	9	70341308	missense	probably damaging	1.00
R0238:Myo1e	UTSW	9	70342126	missense	possibly damaging	0.86
R0238:Myo1e	UTSW	9	70342126	missense	possibly damaging	0.86
R0399:Myo1e	UTSW	9	70301793	splice site	probably benign
R0526:Myo1e	UTSW	9	70322398	missense	probably damaging	1.00
R0656:Myo1e	UTSW	9	70367674	missense	probably damaging	1.00
R1078:Myo1e	UTSW	9	70383999	missense	probably benign
R1278:Myo1e	UTSW	9	70398785	missense	probably damaging	1.00
R1300:Myo1e	UTSW	9	70301783	missense	probably damaging	1.00
R1329:Myo1e	UTSW	9	70338738	missense	possibly damaging	0.96
R1349:Myo1e	UTSW	9	70287069	splice site	probably benign
R1463:Myo1e	UTSW	9	70338756	missense	possibly damaging	0.88
R1656:Myo1e	UTSW	9	70395934	missense	probably damaging	1.00
R1727:Myo1e	UTSW	9	70376524	missense	possibly damaging	0.88
R1789:Myo1e	UTSW	9	70338784	missense	probably damaging	1.00
R1970:Myo1e	UTSW	9	70368773	missense	probably benign	0.00
R2029:Myo1e	UTSW	9	70368687	missense	possibly damaging	0.78
R2029:Myo1e	UTSW	9	70378715	splice site	probably benign
R2039:Myo1e	UTSW	9	70320133	missense	possibly damaging	0.89
R2076:Myo1e	UTSW	9	70383877	missense	probably benign
R2256:Myo1e	UTSW	9	70378373	splice site	probably null
R2257:Myo1e	UTSW	9	70378373	splice site	probably null
R2323:Myo1e	UTSW	9	70378758	nonsense	probably null
R2443:Myo1e	UTSW	9	70327172	missense	probably benign
R4023:Myo1e	UTSW	9	70324875	missense	probably benign
R4024:Myo1e	UTSW	9	70324875	missense	probably benign
R4025:Myo1e	UTSW	9	70324875	missense	probably benign
R4026:Myo1e	UTSW	9	70324875	missense	probably benign
R4151:Myo1e	UTSW	9	70297351	nonsense	probably null
R4764:Myo1e	UTSW	9	70343135	splice site	probably null
R4768:Myo1e	UTSW	9	70370469	missense	possibly damaging	0.63
R4911:Myo1e	UTSW	9	70343096	missense	probably benign
R4995:Myo1e	UTSW	9	70353272	missense	probably benign	0.01
R4999:Myo1e	UTSW	9	70353312	missense	probably damaging	1.00
R5228:Myo1e	UTSW	9	70322358	splice site	probably null
R5414:Myo1e	UTSW	9	70322358	splice site	probably null
R5577:Myo1e	UTSW	9	70370471	missense	probably benign	0.31
R5851:Myo1e	UTSW	9	70383804	missense	probably benign	0.17
R6208:Myo1e	UTSW	9	70376605	missense	probably damaging	0.99
R6907:Myo1e	UTSW	9	70327155	missense	probably benign
R7084:Myo1e	UTSW	9	70337801	missense	probably damaging	0.96
R7313:Myo1e	UTSW	9	70359385	critical splice donor site	probably null
R7383:Myo1e	UTSW	9	70297295	missense	probably damaging	1.00
R7811:Myo1e	UTSW	9	70327262	missense	probably damaging	0.96
R7962:Myo1e	UTSW	9	70335219	missense	possibly damaging	0.64
R8309:Myo1e	UTSW	9	70346763	missense	possibly damaging	0.90
R8510:Myo1e	UTSW	9	70335265	missense	probably damaging	1.00
R8513:Myo1e	UTSW	9	70320088	missense	probably damaging	1.00
R8694:Myo1e	UTSW	9	70383890	missense	probably benign
R8720:Myo1e	UTSW	9	70297288	missense	possibly damaging	0.89
R9112:Myo1e	UTSW	9	70367701	missense	probably benign	0.25
R9148:Myo1e	UTSW	9	70376548	missense	probably damaging	0.98
R9156:Myo1e	UTSW	9	70359323	missense	probably damaging	1.00
R9251:Myo1e	UTSW	9	70368794	missense	probably benign	0.00
X0021:Myo1e	UTSW	9	70378273	missense	probably damaging	0.99
X0065:Myo1e	UTSW	9	70378294	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- AGCGGTGTTCAGAACAGGTTCG -3'
(R):5'- TCAACAATGCGTAGAGTCTTGCCC -3'

Sequencing Primer
(F):5'- TTCCTGCCTCCAAATAAGAGTG -3'
(R):5'- CGTAGAGTCTTGCCCATTAGAAC -3'

Posted On

2013-07-11