Incidental Mutation 'R7126:Scn7a'
ID 552301
Institutional Source Beutler Lab
Gene Symbol Scn7a
Ensembl Gene ENSMUSG00000034810
Gene Name sodium channel, voltage-gated, type VII, alpha
Synonyms NaG, Nav2, Nav2.3, Nax, Scn6a
MMRRC Submission 045213-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.110) question?
Stock # R7126 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 66673425-66784914 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 66757286 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 24 (H24Q)
Ref Sequence ENSEMBL: ENSMUSP00000042405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042792]
AlphaFold B1AYL1
Predicted Effect possibly damaging
Transcript: ENSMUST00000042792
AA Change: H24Q

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000042405
Gene: ENSMUSG00000034810
AA Change: H24Q

DomainStartEndE-ValueType
Pfam:Ion_trans 118 405 4.7e-53 PFAM
coiled coil region 415 443 N/A INTRINSIC
Pfam:Ion_trans 505 739 5.8e-36 PFAM
Pfam:Na_trans_assoc 741 929 4.1e-17 PFAM
Pfam:Ion_trans 933 1204 3e-49 PFAM
Pfam:Ion_trans 1250 1505 5e-37 PFAM
IQ 1624 1646 6.4e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the many voltage-gated sodium channel proteins. For proper functioning of neurons and muscles during action potentials, voltage-gated sodium channels direct sodium ion diffusion for membrane depolarization. This sodium channel protein has some atypical characteristics; the similarity between the human and mouse proteins is lower compared to other orthologous sodium channel pairs. Also, the S4 segments, which sense voltage changes, have fewer positive charged residues that in other sodium channels; domain 4 has fewer arginine and lysine residues compared to other sodium channel proteins. Several alternatively spliced transcript variants exist, but the full-length natures of all of them remain unknown. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene have a modified dietary preference for NaCl but are phenotypically normal otherwise. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik C T 17: 23,720,564 V8I probably benign Het
1810062G17Rik T C 3: 36,481,839 C85R unknown Het
3110082I17Rik G T 5: 139,361,250 H153Q unknown Het
Acadsb T C 7: 131,437,448 I316T probably benign Het
Acsbg2 A T 17: 56,846,633 N523K probably damaging Het
Ahnak C T 19: 9,002,359 P336S possibly damaging Het
Ankdd1b A G 13: 96,429,862 V277A possibly damaging Het
Aspm A G 1: 139,480,803 Y2476C probably benign Het
Atg13 G A 2: 91,680,420 R321W probably damaging Het
B4galt2 A G 4: 117,877,538 F211S probably damaging Het
Baiap3 T A 17: 25,245,145 T913S possibly damaging Het
Btbd18 A T 2: 84,666,202 E61D possibly damaging Het
Btnl9 G T 11: 49,169,255 S555R probably damaging Het
Cbs T A 17: 31,619,139 M379L probably benign Het
Chd9 G A 8: 91,015,225 G1614D unknown Het
Cmya5 G A 13: 93,089,940 P2880L probably benign Het
Cnnm1 T C 19: 43,484,853 S729P probably damaging Het
Cox16 T A 12: 81,472,166 E70D probably benign Het
Cp A G 3: 19,980,624 H699R probably damaging Het
Cyp2d26 T C 15: 82,794,008 N56D probably benign Het
Dennd4c A G 4: 86,807,430 Y707C probably damaging Het
Dgcr14 T C 16: 17,911,290 T6A unknown Het
Dnah5 A T 15: 28,349,837 E2555D probably benign Het
Fam129a T A 1: 151,714,567 C537* probably null Het
Filip1 A G 9: 79,898,295 L59P possibly damaging Het
Fsip2 A G 2: 82,983,141 N3268S possibly damaging Het
Gja10 A T 4: 32,601,014 C457S probably benign Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 101,794,171 probably benign Het
Gm47959 G A 1: 83,000,782 G57S unknown Het
Gm4869 A T 5: 140,491,318 D874V probably benign Het
Grid2 T A 6: 64,076,810 V331E probably damaging Het
Inpp4a C A 1: 37,374,272 H123Q probably benign Het
Ireb2 T A 9: 54,886,567 Y260* probably null Het
Itpr2 G A 6: 146,357,796 Q628* probably null Het
Kbtbd11 G A 8: 15,028,759 A453T probably damaging Het
Kcnj2 A G 11: 111,072,822 T347A probably damaging Het
Klhl12 A G 1: 134,467,783 H161R probably damaging Het
Krt78 T C 15: 101,948,436 E412G probably damaging Het
Lzic A G 4: 149,488,675 I95V probably damaging Het
Mme C T 3: 63,368,901 P700S probably damaging Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Mthfd2 A G 6: 83,313,490 V53A probably benign Het
Mtus1 A G 8: 41,015,402 L210P probably damaging Het
Muc16 T C 9: 18,641,216 T4594A probably benign Het
Olfm5 A T 7: 104,159,980 C208S probably damaging Het
Olfr1355 T C 10: 78,879,577 V135A possibly damaging Het
Olfr1368 A T 13: 21,142,718 L113H probably damaging Het
Olfr1494 T A 19: 13,749,523 I139N possibly damaging Het
Parp12 T C 6: 39,111,736 I189V probably benign Het
Plin1 T C 7: 79,726,664 probably null Het
Prl7a1 C T 13: 27,642,419 probably null Het
Ptpn23 T C 9: 110,388,744 D711G probably benign Het
Rgs22 A T 15: 36,103,808 I169N probably damaging Het
Scrt2 C T 2: 152,093,086 P53L probably damaging Het
Sh3rf1 A T 8: 61,349,424 I264L probably benign Het
Smarcd1 A T 15: 99,709,325 D393V probably damaging Het
Spag17 T G 3: 100,101,435 N1960K probably benign Het
Ssb A G 2: 69,866,501 T62A possibly damaging Het
Taar7b T A 10: 24,000,062 Y42N possibly damaging Het
Terf1 A T 1: 15,813,139 I159L probably benign Het
Tff3 T G 17: 31,127,436 N54T probably benign Het
Top2a A G 11: 99,014,992 L285P probably benign Het
Trim24 A G 6: 37,919,457 Y283C probably damaging Het
Trim58 T C 11: 58,640,579 C38R probably damaging Het
Trpa1 T A 1: 14,890,424 T647S probably benign Het
Trpm4 A T 7: 45,310,709 probably null Het
Trpm6 C T 19: 18,854,033 Q1421* probably null Het
Ubr2 A T 17: 46,974,056 probably null Het
Vmn1r46 T G 6: 89,976,994 I275S possibly damaging Het
Vmn2r54 A G 7: 12,632,161 F282S possibly damaging Het
Vmn2r57 A G 7: 41,399,794 S844P possibly damaging Het
Vps13a A C 19: 16,710,879 C855G probably benign Het
Wdr31 T A 4: 62,463,429 Q55L probably benign Het
Other mutations in Scn7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Scn7a APN 2 66683327 splice site probably benign
IGL00432:Scn7a APN 2 66741982 nonsense probably null
IGL00720:Scn7a APN 2 66676044 missense possibly damaging 0.67
IGL00783:Scn7a APN 2 66692564 missense probably damaging 0.99
IGL00784:Scn7a APN 2 66692564 missense probably damaging 0.99
IGL00926:Scn7a APN 2 66684131 missense probably benign 0.06
IGL00963:Scn7a APN 2 66703945 splice site probably benign
IGL01099:Scn7a APN 2 66684238 missense probably damaging 1.00
IGL01326:Scn7a APN 2 66752260 missense probably benign 0.13
IGL01538:Scn7a APN 2 66703852 missense probably benign
IGL01624:Scn7a APN 2 66751925 missense probably benign 0.07
IGL01794:Scn7a APN 2 66675509 missense probably benign
IGL02100:Scn7a APN 2 66675499 makesense probably null
IGL02326:Scn7a APN 2 66700048 missense probably benign 0.00
IGL02472:Scn7a APN 2 66752314 missense probably damaging 1.00
IGL02528:Scn7a APN 2 66700175 missense probably damaging 1.00
IGL02798:Scn7a APN 2 66713875 missense probably benign 0.00
IGL03026:Scn7a APN 2 66676098 missense probably damaging 0.99
IGL03071:Scn7a APN 2 66699947 missense possibly damaging 0.89
IGL03080:Scn7a APN 2 66697816 missense probably benign 0.01
IGL03180:Scn7a APN 2 66676234 missense possibly damaging 0.94
IGL03337:Scn7a APN 2 66675960 missense probably benign 0.00
alert UTSW 2 66680246 nonsense probably null
glimmer UTSW 2 66743703 missense probably damaging 0.96
Uptick UTSW 2 66700049 nonsense probably null
PIT4514001:Scn7a UTSW 2 66684179 missense probably damaging 1.00
R0004:Scn7a UTSW 2 66687795 missense possibly damaging 0.81
R0076:Scn7a UTSW 2 66714037 missense probably benign 0.04
R0230:Scn7a UTSW 2 66726284 missense probably damaging 1.00
R0463:Scn7a UTSW 2 66675740 missense probably benign 0.05
R0846:Scn7a UTSW 2 66697600 missense possibly damaging 0.71
R1237:Scn7a UTSW 2 66680295 missense probably damaging 0.98
R1282:Scn7a UTSW 2 66700849 missense probably damaging 0.98
R1467:Scn7a UTSW 2 66689558 missense probably benign 0.01
R1467:Scn7a UTSW 2 66689558 missense probably benign 0.01
R1501:Scn7a UTSW 2 66700163 missense probably benign 0.37
R1672:Scn7a UTSW 2 66697600 missense possibly damaging 0.71
R1690:Scn7a UTSW 2 66675943 missense probably damaging 0.99
R1712:Scn7a UTSW 2 66705103 missense probably benign 0.05
R1758:Scn7a UTSW 2 66680183 missense probably benign 0.00
R1758:Scn7a UTSW 2 66700887 missense probably damaging 0.97
R1775:Scn7a UTSW 2 66680955 missense probably benign 0.02
R1848:Scn7a UTSW 2 66684013 critical splice donor site probably null
R1851:Scn7a UTSW 2 66680291 missense probably benign
R1919:Scn7a UTSW 2 66699973 missense probably damaging 1.00
R1932:Scn7a UTSW 2 66676102 missense probably damaging 1.00
R1945:Scn7a UTSW 2 66675980 missense probably damaging 1.00
R1970:Scn7a UTSW 2 66684289 missense possibly damaging 0.89
R1998:Scn7a UTSW 2 66683269 missense probably damaging 0.99
R2008:Scn7a UTSW 2 66687747 missense possibly damaging 0.82
R2038:Scn7a UTSW 2 66737436 missense probably damaging 1.00
R2113:Scn7a UTSW 2 66675968 missense probably damaging 1.00
R2128:Scn7a UTSW 2 66697986 missense probably damaging 0.99
R2163:Scn7a UTSW 2 66675956 missense probably damaging 0.97
R2421:Scn7a UTSW 2 66726302 splice site probably benign
R2446:Scn7a UTSW 2 66692658 missense probably damaging 0.98
R2922:Scn7a UTSW 2 66700207 splice site probably benign
R3015:Scn7a UTSW 2 66699896 missense probably benign 0.08
R3034:Scn7a UTSW 2 66682808 missense probably damaging 1.00
R3419:Scn7a UTSW 2 66700895 frame shift probably null
R3429:Scn7a UTSW 2 66700895 frame shift probably null
R3430:Scn7a UTSW 2 66700895 frame shift probably null
R3434:Scn7a UTSW 2 66675503 missense probably benign 0.01
R3803:Scn7a UTSW 2 66680246 nonsense probably null
R3831:Scn7a UTSW 2 66697684 missense probably damaging 0.96
R3833:Scn7a UTSW 2 66697684 missense probably damaging 0.96
R4017:Scn7a UTSW 2 66741985 missense probably damaging 1.00
R4244:Scn7a UTSW 2 66742001 missense probably benign 0.00
R4245:Scn7a UTSW 2 66742001 missense probably benign 0.00
R4276:Scn7a UTSW 2 66684063 missense probably damaging 0.97
R4307:Scn7a UTSW 2 66675755 missense possibly damaging 0.47
R4327:Scn7a UTSW 2 66737471 missense probably damaging 1.00
R4353:Scn7a UTSW 2 66676436 missense probably benign 0.00
R4721:Scn7a UTSW 2 66684185 missense probably damaging 1.00
R4722:Scn7a UTSW 2 66700884 missense possibly damaging 0.95
R4781:Scn7a UTSW 2 66703760 missense possibly damaging 0.95
R4792:Scn7a UTSW 2 66726248 missense probably damaging 1.00
R5362:Scn7a UTSW 2 66699998 missense probably damaging 1.00
R5437:Scn7a UTSW 2 66676346 missense probably damaging 1.00
R5729:Scn7a UTSW 2 66741957 critical splice donor site probably null
R5777:Scn7a UTSW 2 66692569 missense probably damaging 1.00
R5785:Scn7a UTSW 2 66697568 missense possibly damaging 0.79
R5821:Scn7a UTSW 2 66743703 missense probably damaging 0.96
R5830:Scn7a UTSW 2 66714051 nonsense probably null
R5877:Scn7a UTSW 2 66699873 nonsense probably null
R5881:Scn7a UTSW 2 66675526 missense probably benign 0.01
R5967:Scn7a UTSW 2 66675713 missense probably damaging 1.00
R5988:Scn7a UTSW 2 66726214 nonsense probably null
R6077:Scn7a UTSW 2 66697596 missense probably damaging 1.00
R6135:Scn7a UTSW 2 66703900 missense probably benign
R6242:Scn7a UTSW 2 66700766 missense probably benign 0.00
R6264:Scn7a UTSW 2 66675526 missense possibly damaging 0.93
R6291:Scn7a UTSW 2 66700114 missense probably damaging 0.98
R6544:Scn7a UTSW 2 66684100 missense probably damaging 1.00
R6770:Scn7a UTSW 2 66729184 splice site probably null
R6997:Scn7a UTSW 2 66703803 missense probably damaging 1.00
R7014:Scn7a UTSW 2 66741959 missense probably null 1.00
R7129:Scn7a UTSW 2 66700193 missense probably benign 0.14
R7176:Scn7a UTSW 2 66676288 missense probably damaging 1.00
R7185:Scn7a UTSW 2 66687795 missense possibly damaging 0.81
R7276:Scn7a UTSW 2 66757162 missense probably damaging 1.00
R7332:Scn7a UTSW 2 66692554 nonsense probably null
R7421:Scn7a UTSW 2 66675532 missense probably benign 0.07
R7488:Scn7a UTSW 2 66757230 missense probably benign 0.16
R7636:Scn7a UTSW 2 66743828 missense possibly damaging 0.67
R7685:Scn7a UTSW 2 66676192 missense probably damaging 1.00
R7711:Scn7a UTSW 2 66700877 missense probably damaging 1.00
R7813:Scn7a UTSW 2 66676345 missense probably damaging 1.00
R7833:Scn7a UTSW 2 66676150 missense probably damaging 1.00
R7914:Scn7a UTSW 2 66699950 missense probably damaging 0.97
R7953:Scn7a UTSW 2 66757326 missense possibly damaging 0.90
R7970:Scn7a UTSW 2 66675829 missense probably damaging 1.00
R8061:Scn7a UTSW 2 66692594 missense probably damaging 1.00
R8121:Scn7a UTSW 2 66700859 missense probably damaging 1.00
R8172:Scn7a UTSW 2 66675847 missense possibly damaging 0.90
R8209:Scn7a UTSW 2 66700860 missense possibly damaging 0.88
R8226:Scn7a UTSW 2 66700860 missense possibly damaging 0.88
R8288:Scn7a UTSW 2 66675974 missense probably damaging 1.00
R8431:Scn7a UTSW 2 66703820 missense possibly damaging 0.62
R8678:Scn7a UTSW 2 66743697 splice site probably benign
R8745:Scn7a UTSW 2 66680182 missense probably benign
R8781:Scn7a UTSW 2 66737431 missense probably benign 0.03
R8848:Scn7a UTSW 2 66700049 nonsense probably null
R8878:Scn7a UTSW 2 66675855 missense probably damaging 1.00
R8943:Scn7a UTSW 2 66694862 synonymous silent
R8991:Scn7a UTSW 2 66684244 missense possibly damaging 0.65
R9147:Scn7a UTSW 2 66684163 missense possibly damaging 0.89
R9148:Scn7a UTSW 2 66684163 missense possibly damaging 0.89
R9402:Scn7a UTSW 2 66680112 missense probably damaging 1.00
R9501:Scn7a UTSW 2 66752235 missense probably benign 0.00
R9546:Scn7a UTSW 2 66752259 missense possibly damaging 0.93
R9715:Scn7a UTSW 2 66689558 missense possibly damaging 0.93
X0060:Scn7a UTSW 2 66689682 missense probably benign 0.01
X0066:Scn7a UTSW 2 66680192 missense probably benign
Z1088:Scn7a UTSW 2 66713951 missense probably damaging 0.98
Z1177:Scn7a UTSW 2 66752269 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAAGTGGCTGAATATAAGCGAAG -3'
(R):5'- AGTCTGAAATTGTAGGGGAGAGTTC -3'

Sequencing Primer
(F):5'- GGGTTCCATAGGGAATTGG -3'
(R):5'- AAATTGTAGGGGAGAGTTCTTTGAAC -3'
Posted On 2019-05-15