Mutagenetix > Incidental Mutations

Incidental Mutation 'R0599:Ros1'

55232

Institutional Source

Beutler Lab

Gene Symbol

Ros1

Ensembl Gene

ENSMUSG00000019893

Gene Name

Ros1 proto-oncogene

Synonyms

Ros-1, c-ros

MMRRC Submission

038788-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.188) question?

Stock #

R0599 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

52045721-52195244 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 52123300 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 1164 (Y1164N)

Ref Sequence

ENSEMBL: ENSMUSP00000151720 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020045] [ENSMUST00000218452] [ENSMUST00000219173] [ENSMUST00000219692]

Predicted Effect

probably damaging
Transcript: ENSMUST00000020045
AA Change: Y1185N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020045
Gene: ENSMUSG00000019893
AA Change: Y1185N

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
FN3	109	187	1.05e-4	SMART
FN3	205	282	7.45e-10	SMART
LY	369	409	9.17e0	SMART
FN3	568	654	2.24e-4	SMART
LY	734	776	2.28e1	SMART
LY	777	815	4.61e0	SMART
FN3	944	1023	5.53e-4	SMART
FN3	1037	1133	1.07e1	SMART
FN3	1440	1532	1.19e1	SMART
FN3	1551	1637	2.11e0	SMART
FN3	1649	1731	6.8e-4	SMART
FN3	1746	1832	2.7e1	SMART
TyrKc	1938	2208	1.3e-145	SMART
low complexity region	2294	2307	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000117992
AA Change: Y1164N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112873
Gene: ENSMUSG00000019893
AA Change: Y1164N

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
FN3	109	187	1.05e-4	SMART
FN3	205	282	7.45e-10	SMART
LY	369	409	9.17e0	SMART
FN3	547	633	2.24e-4	SMART
LY	713	755	2.28e1	SMART
LY	756	794	4.61e0	SMART
FN3	923	1002	5.53e-4	SMART
FN3	1016	1112	1.07e1	SMART
FN3	1419	1511	1.19e1	SMART
FN3	1530	1616	2.11e0	SMART
FN3	1628	1710	6.8e-4	SMART
FN3	1725	1811	2.7e1	SMART
TyrKc	1917	2187	1.3e-145	SMART
low complexity region	2273	2286	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000177378
AA Change: Y1164N

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000134905
Gene: ENSMUSG00000019893
AA Change: Y1164N

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
FN3	109	187	1.05e-4	SMART
FN3	205	282	7.45e-10	SMART
LY	369	409	9.17e0	SMART
FN3	547	633	2.24e-4	SMART
LY	713	755	2.28e1	SMART
LY	756	794	4.61e0	SMART
FN3	923	1002	5.53e-4	SMART
FN3	1016	1112	1.07e1	SMART
Blast:LY	1190	1236	2e-18	BLAST
FN3	1419	1511	1.19e1	SMART
FN3	1530	1616	2.11e0	SMART
FN3	1628	1710	6.8e-4	SMART
FN3	1725	1811	2.7e1	SMART
transmembrane domain	1832	1854	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177387

Predicted Effect

probably damaging
Transcript: ENSMUST00000218452
AA Change: Y1164N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000219173
AA Change: Y1164N

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

probably benign
Transcript: ENSMUST00000219692

Meta Mutation Damage Score

0.1257

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.5%
20x: 95.0%

Validation Efficiency

98% (80/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This proto-oncogene, highly-expressed in a variety of tumor cell lines, belongs to the sevenless subfamily of tyrosine kinase insulin receptor genes. The protein encoded by this gene is a type I integral membrane protein with tyrosine kinase activity. The protein may function as a growth or differentiation factor receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit male infertility due to impaired sperm maturation in the epididymis. Mutant sperm are capable of fertilization in vitro but not in vivo. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	A	G	6: 128,552,245	L978P	probably damaging	Het
Abcb1a	C	T	5: 8,698,539	T290M	probably benign	Het
Abcd3	A	T	3: 121,765,093	F585I	probably damaging	Het
Acan	A	G	7: 79,111,290		probably benign	Het
Anxa6	T	C	11: 54,979,466	D667G	possibly damaging	Het
Ap3m2	G	T	8: 22,793,112	A208D	possibly damaging	Het
Arhgap17	A	T	7: 123,303,790		probably benign	Het
Bptf	A	G	11: 107,068,382	V1838A	probably damaging	Het
Brip1	T	A	11: 86,152,737	M334L	probably benign	Het
Btbd10	C	T	7: 113,335,309		probably benign	Het
Btbd11	G	A	10: 85,658,336	G1106D	probably damaging	Het
Cdh7	C	A	1: 110,052,966	T208K	probably damaging	Het
Cnga4	A	G	7: 105,405,818	Y100C	probably damaging	Het
Dnah10	G	A	5: 124,800,953	V2644M	probably damaging	Het
Dnah9	T	C	11: 65,965,689	D2882G	probably damaging	Het
Eapp	T	A	12: 54,685,962	K117M	probably damaging	Het
Eml3	T	C	19: 8,939,063	V673A	probably benign	Het
Ephb4	G	A	5: 137,369,855	C754Y	probably damaging	Het
Eps8l1	A	G	7: 4,477,957	D33G	possibly damaging	Het
Farsa	A	G	8: 84,867,583	K321E	probably damaging	Het
Fry	G	A	5: 150,437,159	R2090Q	probably damaging	Het
Gm10283	A	G	8: 60,501,224		probably benign	Het
Grm4	A	G	17: 27,431,490	I844T	probably benign	Het
Gtf2h3	A	G	5: 124,588,628	D124G	probably benign	Het
Gulo	A	T	14: 65,990,441	D347E	probably damaging	Het
Hmcn1	A	G	1: 150,609,801	F4350S	possibly damaging	Het
Hspg2	A	G	4: 137,512,401	D473G	probably damaging	Het
Il17ra	T	A	6: 120,481,505	I539N	probably damaging	Het
Insrr	A	G	3: 87,813,133	E1026G	probably damaging	Het
Itga2	A	T	13: 114,856,650		probably benign	Het
Kdm1b	A	T	13: 47,058,810	D190V	possibly damaging	Het
Lima1	A	T	15: 99,802,159	N146K	probably damaging	Het
Mettl7a3	A	T	15: 100,335,383	N152Y	possibly damaging	Het
Mnt	G	T	11: 74,842,296	V85L	probably benign	Het
Mon2	T	A	10: 123,026,065		probably benign	Het
Mtf1	T	C	4: 124,820,201		probably benign	Het
Mylk4	T	C	13: 32,712,754		probably null	Het
Myo18b	A	C	5: 112,865,750	L780R	probably damaging	Het
Myo1e	A	G	9: 70,376,660		probably benign	Het
Obscn	A	G	11: 59,073,696	S705P	probably damaging	Het
Ocrl	A	T	X: 47,936,086		probably benign	Het
Olfr1260	T	C	2: 89,978,201	F141S	probably benign	Het
Olfr394	A	T	11: 73,887,904	M156K	probably benign	Het
Olfr599	A	G	7: 103,338,186	N44S	probably damaging	Het
Olfr639	A	T	7: 104,012,188	C171*	probably null	Het
Otof	T	A	5: 30,370,705	K1931N	probably damaging	Het
Plcxd3	A	G	15: 4,516,867	S118G	probably damaging	Het
Plcz1	T	A	6: 140,028,542	Q58L	probably benign	Het
Proser1	C	A	3: 53,479,064	P789Q	probably benign	Het
Rassf4	T	C	6: 116,645,936	E38G	probably damaging	Het
Rpgrip1l	A	G	8: 91,305,000	I83T	probably damaging	Het
Scn9a	T	G	2: 66,526,799	K1053Q	probably damaging	Het
Sgsm1	G	T	5: 113,245,028	Q1087K	probably damaging	Het
Slc16a10	T	C	10: 40,141,918	D40G	probably benign	Het
Slc27a6	A	G	18: 58,556,813	D117G	probably damaging	Het
Slc2a9	T	A	5: 38,480,144		probably benign	Het
Slc4a1	A	G	11: 102,357,915		probably benign	Het
Smarca1	T	A	X: 47,823,426	Q982L	probably benign	Het
Sp100	T	A	1: 85,681,110	I320N	possibly damaging	Het
Stx8	A	T	11: 68,109,362	R209S	probably null	Het
Sulf2	T	C	2: 166,083,879	T453A	possibly damaging	Het
Syne2	AGAGTGAG	AGAGTGAGTGAG	12: 76,097,960		probably null	Het
Tenm2	T	A	11: 36,024,780	I1976F	possibly damaging	Het
Tenm3	G	A	8: 48,277,710	S1341L	probably damaging	Het
Tmem130	C	T	5: 144,737,809	V369M	probably damaging	Het
Tmem200c	A	G	17: 68,840,511	K30E	probably damaging	Het
Tmem225	A	G	9: 40,149,747	I117V	possibly damaging	Het
Top2a	A	G	11: 99,001,417	I1073T	probably damaging	Het
Trps1	A	C	15: 50,831,860	Y296*	probably null	Het
Tubg1	T	C	11: 101,125,336	M377T	probably benign	Het
Vmn1r35	G	A	6: 66,679,513	H58Y	probably benign	Het
Vmn1r56	G	A	7: 5,196,430	H63Y	probably benign	Het
Vmn1r75	T	C	7: 11,881,262		probably null	Het
Vnn3	T	C	10: 23,865,705	S303P	possibly damaging	Het
Wdr49	C	T	3: 75,431,076		probably null	Het
Wdr49	T	C	3: 75,449,890		probably null	Het
Zcchc6	A	G	13: 59,809,487	V7A	probably damaging	Het
Zzef1	T	C	11: 72,913,178	L2582P	probably damaging	Het

Other mutations in Ros1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00236:Ros1	APN	10	52194890	missense	probably benign	0.01
IGL00338:Ros1	APN	10	52125811	missense	probably benign
IGL00419:Ros1	APN	10	52091054	missense	probably damaging	0.97
IGL00840:Ros1	APN	10	52144873	missense	possibly damaging	0.92
IGL00841:Ros1	APN	10	52144873	missense	possibly damaging	0.92
IGL00951:Ros1	APN	10	52143252	missense	probably damaging	0.99
IGL01123:Ros1	APN	10	52120809	missense	probably damaging	1.00
IGL01128:Ros1	APN	10	52142328	nonsense	probably null
IGL01300:Ros1	APN	10	52101713	missense	probably benign	0.01
IGL01316:Ros1	APN	10	52087879	critical splice donor site	probably null
IGL01349:Ros1	APN	10	52051026	missense	probably damaging	0.99
IGL01363:Ros1	APN	10	52166142	missense	probably damaging	1.00
IGL01457:Ros1	APN	10	52046330	splice site	probably benign
IGL01532:Ros1	APN	10	52090938	splice site	probably benign
IGL01585:Ros1	APN	10	52155102	missense	probably damaging	1.00
IGL01650:Ros1	APN	10	52154979	missense	probably damaging	0.99
IGL01672:Ros1	APN	10	52101803	missense	possibly damaging	0.92
IGL01904:Ros1	APN	10	52077911	missense	probably damaging	0.97
IGL02040:Ros1	APN	10	52115922	missense	probably damaging	0.99
IGL02053:Ros1	APN	10	52162720	missense	probably damaging	1.00
IGL02147:Ros1	APN	10	52120895	missense	probably damaging	1.00
IGL02169:Ros1	APN	10	52081957	critical splice donor site	probably null
IGL02247:Ros1	APN	10	52129581	missense	probably damaging	0.99
IGL02262:Ros1	APN	10	52178969	missense	probably damaging	0.96
IGL02307:Ros1	APN	10	52128438	missense	possibly damaging	0.53
IGL02398:Ros1	APN	10	52144884	splice site	probably benign
IGL02525:Ros1	APN	10	52116042	missense	possibly damaging	0.66
IGL02718:Ros1	APN	10	52118232	missense	probably damaging	1.00
IGL02721:Ros1	APN	10	52172831	splice site	probably benign
IGL02808:Ros1	APN	10	52125889	missense	probably damaging	1.00
IGL03009:Ros1	APN	10	52145907	missense	probably benign	0.00
IGL03035:Ros1	APN	10	52075984	splice site	probably benign
IGL03092:Ros1	APN	10	52098806	missense	probably damaging	0.99
IGL03309:Ros1	APN	10	52118261	missense	possibly damaging	0.83
IGL03333:Ros1	APN	10	52155171	missense	probably damaging	1.00
R0049:Ros1	UTSW	10	52101761	missense	possibly damaging	0.66
R0049:Ros1	UTSW	10	52101761	missense	possibly damaging	0.66
R0050:Ros1	UTSW	10	52101803	missense	probably damaging	0.97
R0050:Ros1	UTSW	10	52101803	missense	probably damaging	0.97
R0057:Ros1	UTSW	10	52180191	missense	probably benign	0.00
R0057:Ros1	UTSW	10	52180191	missense	probably benign	0.00
R0106:Ros1	UTSW	10	52142267	missense	possibly damaging	0.85
R0106:Ros1	UTSW	10	52142267	missense	possibly damaging	0.85
R0125:Ros1	UTSW	10	52125789	missense	probably benign	0.38
R0403:Ros1	UTSW	10	52143438	splice site	probably benign
R0487:Ros1	UTSW	10	52155108	missense	possibly damaging	0.69
R0502:Ros1	UTSW	10	52194823	splice site	probably benign
R0557:Ros1	UTSW	10	52085263	missense	possibly damaging	0.82
R0620:Ros1	UTSW	10	52118348	missense	probably damaging	1.00
R0679:Ros1	UTSW	10	52066295	missense	possibly damaging	0.95
R1005:Ros1	UTSW	10	52128405	splice site	probably benign
R1073:Ros1	UTSW	10	52046125	missense	probably damaging	1.00
R1220:Ros1	UTSW	10	52098870	missense	probably damaging	0.97
R1279:Ros1	UTSW	10	52142166	missense	possibly damaging	0.81
R1295:Ros1	UTSW	10	52087932	missense	possibly damaging	0.92
R1336:Ros1	UTSW	10	52168662	missense	probably damaging	1.00
R1371:Ros1	UTSW	10	52087945	missense	probably damaging	0.98
R1447:Ros1	UTSW	10	52098858	missense	possibly damaging	0.66
R1486:Ros1	UTSW	10	52172858	missense	probably damaging	1.00
R1499:Ros1	UTSW	10	52098677	missense	possibly damaging	0.92
R1669:Ros1	UTSW	10	52161811	missense	probably damaging	1.00
R1744:Ros1	UTSW	10	52123379	missense	probably damaging	0.99
R1759:Ros1	UTSW	10	52120826	missense	probably damaging	1.00
R1791:Ros1	UTSW	10	52100087	missense	probably benign	0.00
R1794:Ros1	UTSW	10	52124103	nonsense	probably null
R2031:Ros1	UTSW	10	52067068	missense	possibly damaging	0.88
R2115:Ros1	UTSW	10	52128555	missense	probably benign	0.00
R2219:Ros1	UTSW	10	52166079	missense	probably damaging	1.00
R2290:Ros1	UTSW	10	52118381	missense	probably damaging	0.96
R2329:Ros1	UTSW	10	52162887	missense	probably damaging	1.00
R2371:Ros1	UTSW	10	52163895	missense	possibly damaging	0.66
R2879:Ros1	UTSW	10	52172840	critical splice donor site	probably null
R3154:Ros1	UTSW	10	52050981	missense	probably benign
R3423:Ros1	UTSW	10	52128416	unclassified	probably null
R3424:Ros1	UTSW	10	52128416	unclassified	probably null
R3425:Ros1	UTSW	10	52128416	unclassified	probably null
R3433:Ros1	UTSW	10	52091108	missense	probably benign	0.45
R3522:Ros1	UTSW	10	52090995	nonsense	probably null
R3686:Ros1	UTSW	10	52145816	missense	probably damaging	1.00
R3710:Ros1	UTSW	10	52161895	nonsense	probably null
R3771:Ros1	UTSW	10	52128991	missense	probably damaging	0.97
R3808:Ros1	UTSW	10	52120848	missense	probably benign	0.08
R3930:Ros1	UTSW	10	52194848	missense	possibly damaging	0.92
R3950:Ros1	UTSW	10	52066388	missense	probably damaging	1.00
R3981:Ros1	UTSW	10	52120878	missense	possibly damaging	0.46
R4007:Ros1	UTSW	10	52118232	missense	probably damaging	1.00
R4346:Ros1	UTSW	10	52168609	missense	possibly damaging	0.92
R4382:Ros1	UTSW	10	52120959	missense	possibly damaging	0.46
R4414:Ros1	UTSW	10	52162704	critical splice donor site	probably null
R4450:Ros1	UTSW	10	52077942	missense	probably damaging	0.98
R4468:Ros1	UTSW	10	52118356	missense	probably damaging	1.00
R4569:Ros1	UTSW	10	52163994	missense	probably damaging	0.99
R4649:Ros1	UTSW	10	52129668	missense	possibly damaging	0.66
R4684:Ros1	UTSW	10	52129096	missense	probably damaging	1.00
R4706:Ros1	UTSW	10	52101894	missense	possibly damaging	0.95
R4731:Ros1	UTSW	10	52142229	missense	probably damaging	1.00
R4748:Ros1	UTSW	10	52115997	missense	probably benign	0.00
R4806:Ros1	UTSW	10	52096175	missense	probably damaging	0.96
R4865:Ros1	UTSW	10	52172870	missense	probably damaging	0.99
R4973:Ros1	UTSW	10	52154991	missense	probably damaging	0.98
R5022:Ros1	UTSW	10	52124075	missense	possibly damaging	0.46
R5033:Ros1	UTSW	10	52128416	critical splice donor site	probably null
R5082:Ros1	UTSW	10	52163941	missense	possibly damaging	0.66
R5083:Ros1	UTSW	10	52163941	missense	possibly damaging	0.66
R5130:Ros1	UTSW	10	52163941	missense	possibly damaging	0.66
R5269:Ros1	UTSW	10	52051008	missense	probably damaging	1.00
R5399:Ros1	UTSW	10	52090944	critical splice donor site	probably null
R5414:Ros1	UTSW	10	52155093	missense	probably damaging	1.00
R5659:Ros1	UTSW	10	52143386	missense	possibly damaging	0.92
R5742:Ros1	UTSW	10	52142138	critical splice donor site	probably null
R5780:Ros1	UTSW	10	52194857	missense	probably damaging	1.00
R5805:Ros1	UTSW	10	52123289	missense	probably damaging	1.00
R5843:Ros1	UTSW	10	52166197	missense	possibly damaging	0.92
R5881:Ros1	UTSW	10	52181798	missense	probably benign	0.26
R6027:Ros1	UTSW	10	52163968	missense	possibly damaging	0.82
R6035:Ros1	UTSW	10	52077971	missense	probably benign
R6035:Ros1	UTSW	10	52077971	missense	probably benign
R6052:Ros1	UTSW	10	52163903	missense	probably benign	0.39
R6175:Ros1	UTSW	10	52101785	missense	probably benign	0.02
R6315:Ros1	UTSW	10	52118210	missense	probably benign
R6342:Ros1	UTSW	10	52155255	missense	probably damaging	1.00
R6470:Ros1	UTSW	10	52166044	critical splice donor site	probably null
R6527:Ros1	UTSW	10	52143377	missense	possibly damaging	0.66
R6568:Ros1	UTSW	10	52162812	missense	probably damaging	1.00
R6573:Ros1	UTSW	10	52155010	missense	possibly damaging	0.84
R6653:Ros1	UTSW	10	52142203	missense	probably damaging	1.00
R6959:Ros1	UTSW	10	52163994	missense	probably damaging	0.99
R7011:Ros1	UTSW	10	52180176	missense	probably damaging	1.00
R7111:Ros1	UTSW	10	52181810	missense	probably benign	0.02
R7243:Ros1	UTSW	10	52123381	missense	probably damaging	1.00
R7355:Ros1	UTSW	10	52166079	missense	probably damaging	1.00
R7385:Ros1	UTSW	10	52155126	missense	probably benign	0.00
R7460:Ros1	UTSW	10	52118203	missense	probably damaging	1.00
R7549:Ros1	UTSW	10	52145834	missense	probably damaging	0.96
R7573:Ros1	UTSW	10	52169976	missense	probably benign	0.03
R7650:Ros1	UTSW	10	52046209	missense	probably benign	0.00
R7667:Ros1	UTSW	10	52163971	missense	probably damaging	1.00
R7696:Ros1	UTSW	10	52142283	missense	probably damaging	1.00
R7785:Ros1	UTSW	10	52162848	missense	probably damaging	1.00
R7814:Ros1	UTSW	10	52096137	missense	probably benign	0.28
R7830:Ros1	UTSW	10	52154934	missense	probably damaging	0.99
RF018:Ros1	UTSW	10	52155121	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CAGTCATTCTAATCTTGAAGGCTCCCC -3'
(R):5'- GTGTTAGACAAACCTGAAGTGGCCC -3'

Sequencing Primer
(F):5'- TTGAAGGCTCCCCCACTG -3'
(R):5'- cttcttcttcttcttcttcttctcc -3'

Posted On

2013-07-11