Incidental Mutation 'R7126:Acadsb'
ID552327
Institutional Source Beutler Lab
Gene Symbol Acadsb
Ensembl Gene ENSMUSG00000030861
Gene Nameacyl-Coenzyme A dehydrogenase, short/branched chain
Synonyms1300003O09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7126 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location131410601-131448944 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 131437448 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 316 (I316T)
Ref Sequence ENSEMBL: ENSMUSP00000113948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015829] [ENSMUST00000117518] [ENSMUST00000124096]
Predicted Effect probably benign
Transcript: ENSMUST00000015829
AA Change: I316T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000015829
Gene: ENSMUSG00000030861
AA Change: I316T

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 58 170 9.9e-30 PFAM
Pfam:Acyl-CoA_dh_M 173 268 6.9e-29 PFAM
Pfam:Acyl-CoA_dh_1 280 428 6.5e-51 PFAM
Pfam:Acyl-CoA_dh_2 295 418 4.4e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117518
AA Change: I316T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000113948
Gene: ENSMUSG00000030861
AA Change: I316T

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 58 170 2.9e-29 PFAM
Pfam:Acyl-CoA_dh_M 173 268 1.2e-28 PFAM
Pfam:Acyl-CoA_dh_1 280 414 1.4e-41 PFAM
Pfam:Acyl-CoA_dh_2 295 415 2.6e-24 PFAM
transmembrane domain 417 439 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Short/branched chain acyl-CoA dehydrogenase(ACADSB) is a member of the acyl-CoA dehydrogenase family of enzymes that catalyze the dehydrogenation of acyl-CoA derivatives in the metabolism of fatty acids or branch chained amino acids. Substrate specificity is the primary characteristic used to define members of this gene family. The ACADSB gene product has the greatest activity towards the short branched chain acyl-CoA derivative, (S)-2-methylbutyryl-CoA, but also reacts significantly with other 2-methyl branched chain substrates and with short straight chain acyl-CoAs. The cDNA encodes for a mitochondrial precursor protein which is cleaved upon mitochondrial import and predicted to yield a mature peptide of approximately 43.7-KDa. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik C T 17: 23,720,564 V8I probably benign Het
1810062G17Rik T C 3: 36,481,839 C85R unknown Het
3110082I17Rik G T 5: 139,361,250 H153Q unknown Het
Acsbg2 A T 17: 56,846,633 N523K probably damaging Het
Ahnak C T 19: 9,002,359 P336S possibly damaging Het
Ankdd1b A G 13: 96,429,862 V277A possibly damaging Het
Aspm A G 1: 139,480,803 Y2476C probably benign Het
Atg13 G A 2: 91,680,420 R321W probably damaging Het
B4galt2 A G 4: 117,877,538 F211S probably damaging Het
Baiap3 T A 17: 25,245,145 T913S possibly damaging Het
Btbd18 A T 2: 84,666,202 E61D possibly damaging Het
Btnl9 G T 11: 49,169,255 S555R probably damaging Het
Cbs T A 17: 31,619,139 M379L probably benign Het
Chd9 G A 8: 91,015,225 G1614D unknown Het
Cmya5 G A 13: 93,089,940 P2880L probably benign Het
Cnnm1 T C 19: 43,484,853 S729P probably damaging Het
Cox16 T A 12: 81,472,166 E70D probably benign Het
Cp A G 3: 19,980,624 H699R probably damaging Het
Cyp2d26 T C 15: 82,794,008 N56D probably benign Het
Dennd4c A G 4: 86,807,430 Y707C probably damaging Het
Dgcr14 T C 16: 17,911,290 T6A unknown Het
Dnah5 A T 15: 28,349,837 E2555D probably benign Het
Fam129a T A 1: 151,714,567 C537* probably null Het
Filip1 A G 9: 79,898,295 L59P possibly damaging Het
Fsip2 A G 2: 82,983,141 N3268S possibly damaging Het
Gja10 A T 4: 32,601,014 C457S probably benign Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 101,794,171 probably benign Het
Gm47959 G A 1: 83,000,782 G57S unknown Het
Gm4869 A T 5: 140,491,318 D874V probably benign Het
Grid2 T A 6: 64,076,810 V331E probably damaging Het
Inpp4a C A 1: 37,374,272 H123Q probably benign Het
Ireb2 T A 9: 54,886,567 Y260* probably null Het
Itpr2 G A 6: 146,357,796 Q628* probably null Het
Kbtbd11 G A 8: 15,028,759 A453T probably damaging Het
Kcnj2 A G 11: 111,072,822 T347A probably damaging Het
Klhl12 A G 1: 134,467,783 H161R probably damaging Het
Krt78 T C 15: 101,948,436 E412G probably damaging Het
Lzic A G 4: 149,488,675 I95V probably damaging Het
Mme C T 3: 63,368,901 P700S probably damaging Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Mthfd2 A G 6: 83,313,490 V53A probably benign Het
Mtus1 A G 8: 41,015,402 L210P probably damaging Het
Muc16 T C 9: 18,641,216 T4594A probably benign Het
Olfm5 A T 7: 104,159,980 C208S probably damaging Het
Olfr1355 T C 10: 78,879,577 V135A possibly damaging Het
Olfr1368 A T 13: 21,142,718 L113H probably damaging Het
Olfr1494 T A 19: 13,749,523 I139N possibly damaging Het
Parp12 T C 6: 39,111,736 I189V probably benign Het
Plin1 T C 7: 79,726,664 probably null Het
Prl7a1 C T 13: 27,642,419 probably null Het
Ptpn23 T C 9: 110,388,744 D711G probably benign Het
Rgs22 A T 15: 36,103,808 I169N probably damaging Het
Scn7a G T 2: 66,757,286 H24Q possibly damaging Het
Scrt2 C T 2: 152,093,086 P53L probably damaging Het
Sh3rf1 A T 8: 61,349,424 I264L probably benign Het
Smarcd1 A T 15: 99,709,325 D393V probably damaging Het
Spag17 T G 3: 100,101,435 N1960K probably benign Het
Ssb A G 2: 69,866,501 T62A possibly damaging Het
Taar7b T A 10: 24,000,062 Y42N possibly damaging Het
Terf1 A T 1: 15,813,139 I159L probably benign Het
Tff3 T G 17: 31,127,436 N54T probably benign Het
Top2a A G 11: 99,014,992 L285P probably benign Het
Trim24 A G 6: 37,919,457 Y283C probably damaging Het
Trim58 T C 11: 58,640,579 C38R probably damaging Het
Trpa1 T A 1: 14,890,424 T647S probably benign Het
Trpm4 A T 7: 45,310,709 probably null Het
Trpm6 C T 19: 18,854,033 Q1421* probably null Het
Ubr2 A T 17: 46,974,056 probably null Het
Vmn1r46 T G 6: 89,976,994 I275S possibly damaging Het
Vmn2r54 A G 7: 12,632,161 F282S possibly damaging Het
Vmn2r57 A G 7: 41,399,794 S844P possibly damaging Het
Vps13a A C 19: 16,710,879 C855G probably benign Het
Wdr31 T A 4: 62,463,429 Q55L probably benign Het
Other mutations in Acadsb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00581:Acadsb APN 7 131437496 intron probably benign
IGL02002:Acadsb APN 7 131428529 missense probably damaging 1.00
IGL02147:Acadsb APN 7 131425881 splice site probably benign
IGL02614:Acadsb APN 7 131424628 missense probably benign 0.00
IGL03038:Acadsb APN 7 131428456 missense probably damaging 1.00
IGL03083:Acadsb APN 7 131441193 intron probably benign
R0491:Acadsb UTSW 7 131430107 missense probably benign 0.41
R0562:Acadsb UTSW 7 131425789 nonsense probably null
R0989:Acadsb UTSW 7 131428544 missense probably damaging 0.99
R1701:Acadsb UTSW 7 131424484 missense probably benign 0.00
R1827:Acadsb UTSW 7 131441275 missense probably damaging 1.00
R1860:Acadsb UTSW 7 131444229 splice site probably null
R2256:Acadsb UTSW 7 131443653 missense probably benign 0.23
R3798:Acadsb UTSW 7 131431965 missense probably damaging 1.00
R4519:Acadsb UTSW 7 131430004 missense probably damaging 0.99
R5020:Acadsb UTSW 7 131441200 critical splice acceptor site probably null
R5048:Acadsb UTSW 7 131437469 missense probably damaging 1.00
R5243:Acadsb UTSW 7 131444243 missense probably damaging 1.00
R5519:Acadsb UTSW 7 131429965 missense probably damaging 1.00
R5788:Acadsb UTSW 7 131443599 missense probably benign 0.23
R5855:Acadsb UTSW 7 131424599 missense probably damaging 1.00
R6399:Acadsb UTSW 7 131430055 missense probably damaging 1.00
R6896:Acadsb UTSW 7 131443646 missense probably benign 0.23
R6970:Acadsb UTSW 7 131434315 missense possibly damaging 0.85
R7031:Acadsb UTSW 7 131443637 missense probably benign 0.23
R7138:Acadsb UTSW 7 131441239 missense probably damaging 1.00
R7571:Acadsb UTSW 7 131443554 missense probably damaging 1.00
R7697:Acadsb UTSW 7 131429969 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATACCCAAGGTACCTGCCAG -3'
(R):5'- TAAGATGGCCACAGCGTATC -3'

Sequencing Primer
(F):5'- AAGGTACCTGCCAGCTCTG -3'
(R):5'- ATGGCCACAGCGTATCCCATG -3'
Posted On2019-05-15