Mutagenetix > Incidental Mutations

Incidental Mutation 'R7126:Muc16'

552332

Institutional Source

Beutler Lab

Gene Symbol

Muc16

Ensembl Gene

ENSMUSG00000109564

Gene Name

mucin 16

Synonyms

1110008I14Rik, LOC385009

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.231) question?

Stock #

R7126 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

18495455-18674530 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 18641216 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 4594 (T4594A)

Ref Sequence

ENSEMBL: ENSMUSP00000147104 (fasta)

Predicted Effect

probably benign
Transcript: ENSMUST00000208663
AA Change: T4594A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

97% (73/75)

MGI Phenotype

PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1520401A03Rik	C	T	17: 23,720,564	V8I	probably benign	Het
1810062G17Rik	T	C	3: 36,481,839	C85R	unknown	Het
3110082I17Rik	G	T	5: 139,361,250	H153Q	unknown	Het
Acadsb	T	C	7: 131,437,448	I316T	probably benign	Het
Acsbg2	A	T	17: 56,846,633	N523K	probably damaging	Het
Ahnak	C	T	19: 9,002,359	P336S	possibly damaging	Het
Ankdd1b	A	G	13: 96,429,862	V277A	possibly damaging	Het
Aspm	A	G	1: 139,480,803	Y2476C	probably benign	Het
Atg13	G	A	2: 91,680,420	R321W	probably damaging	Het
B4galt2	A	G	4: 117,877,538	F211S	probably damaging	Het
Baiap3	T	A	17: 25,245,145	T913S	possibly damaging	Het
Btbd18	A	T	2: 84,666,202	E61D	possibly damaging	Het
Btnl9	G	T	11: 49,169,255	S555R	probably damaging	Het
Cbs	T	A	17: 31,619,139	M379L	probably benign	Het
Chd9	G	A	8: 91,015,225	G1614D	unknown	Het
Cmya5	G	A	13: 93,089,940	P2880L	probably benign	Het
Cnnm1	T	C	19: 43,484,853	S729P	probably damaging	Het
Cox16	T	A	12: 81,472,166	E70D	probably benign	Het
Cp	A	G	3: 19,980,624	H699R	probably damaging	Het
Cyp2d26	T	C	15: 82,794,008	N56D	probably benign	Het
Dennd4c	A	G	4: 86,807,430	Y707C	probably damaging	Het
Dgcr14	T	C	16: 17,911,290	T6A	unknown	Het
Dnah5	A	T	15: 28,349,837	E2555D	probably benign	Het
Fam129a	T	A	1: 151,714,567	C537*	probably null	Het
Filip1	A	G	9: 79,898,295	L59P	possibly damaging	Het
Fsip2	A	G	2: 82,983,141	N3268S	possibly damaging	Het
Gja10	A	T	4: 32,601,014	C457S	probably benign	Het
Gm4779	TCGGGGCCGGGGCCGGGGCCG	TCGGGGCCGGGGCCGGGGCCGGGGCCG	X: 101,794,171		probably benign	Het
Gm47959	G	A	1: 83,000,782	G57S	unknown	Het
Gm4869	A	T	5: 140,491,318	D874V	probably benign	Het
Grid2	T	A	6: 64,076,810	V331E	probably damaging	Het
Inpp4a	C	A	1: 37,374,272	H123Q	probably benign	Het
Ireb2	T	A	9: 54,886,567	Y260*	probably null	Het
Itpr2	G	A	6: 146,357,796	Q628*	probably null	Het
Kbtbd11	G	A	8: 15,028,759	A453T	probably damaging	Het
Kcnj2	A	G	11: 111,072,822	T347A	probably damaging	Het
Klhl12	A	G	1: 134,467,783	H161R	probably damaging	Het
Krt78	T	C	15: 101,948,436	E412G	probably damaging	Het
Lzic	A	G	4: 149,488,675	I95V	probably damaging	Het
Mme	C	T	3: 63,368,901	P700S	probably damaging	Het
Mroh2a	G	T	1: 88,254,935	R1195L	possibly damaging	Het
Mthfd2	A	G	6: 83,313,490	V53A	probably benign	Het
Mtus1	A	G	8: 41,015,402	L210P	probably damaging	Het
Olfm5	A	T	7: 104,159,980	C208S	probably damaging	Het
Olfr1355	T	C	10: 78,879,577	V135A	possibly damaging	Het
Olfr1368	A	T	13: 21,142,718	L113H	probably damaging	Het
Olfr1494	T	A	19: 13,749,523	I139N	possibly damaging	Het
Parp12	T	C	6: 39,111,736	I189V	probably benign	Het
Plin1	T	C	7: 79,726,664		probably null	Het
Prl7a1	C	T	13: 27,642,419		probably null	Het
Ptpn23	T	C	9: 110,388,744	D711G	probably benign	Het
Rgs22	A	T	15: 36,103,808	I169N	probably damaging	Het
Scn7a	G	T	2: 66,757,286	H24Q	possibly damaging	Het
Scrt2	C	T	2: 152,093,086	P53L	probably damaging	Het
Sh3rf1	A	T	8: 61,349,424	I264L	probably benign	Het
Smarcd1	A	T	15: 99,709,325	D393V	probably damaging	Het
Spag17	T	G	3: 100,101,435	N1960K	probably benign	Het
Ssb	A	G	2: 69,866,501	T62A	possibly damaging	Het
Taar7b	T	A	10: 24,000,062	Y42N	possibly damaging	Het
Terf1	A	T	1: 15,813,139	I159L	probably benign	Het
Tff3	T	G	17: 31,127,436	N54T	probably benign	Het
Top2a	A	G	11: 99,014,992	L285P	probably benign	Het
Trim24	A	G	6: 37,919,457	Y283C	probably damaging	Het
Trim58	T	C	11: 58,640,579	C38R	probably damaging	Het
Trpa1	T	A	1: 14,890,424	T647S	probably benign	Het
Trpm4	A	T	7: 45,310,709		probably null	Het
Trpm6	C	T	19: 18,854,033	Q1421*	probably null	Het
Ubr2	A	T	17: 46,974,056		probably null	Het
Vmn1r46	T	G	6: 89,976,994	I275S	possibly damaging	Het
Vmn2r54	A	G	7: 12,632,161	F282S	possibly damaging	Het
Vmn2r57	A	G	7: 41,399,794	S844P	possibly damaging	Het
Vps13a	A	C	19: 16,710,879	C855G	probably benign	Het
Wdr31	T	A	4: 62,463,429	Q55L	probably benign	Het

Other mutations in Muc16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01330:Muc16	APN	9	18508507	missense	possibly damaging	0.89
IGL01878:Muc16	APN	9	18495543	missense	possibly damaging	0.90
IGL02394:Muc16	APN	9	18498700	missense	probably damaging	0.99
IGL02553:Muc16	APN	9	18498553	critical splice donor site	probably null
R0400:Muc16	UTSW	9	18510534	missense	possibly damaging	0.74
R1620:Muc16	UTSW	9	18510477	missense	possibly damaging	0.89
R1695:Muc16	UTSW	9	18497433	missense	probably damaging	1.00
R3196:Muc16	UTSW	9	18497830	missense	probably damaging	1.00
R5982:Muc16	UTSW	9	18647146	missense	unknown
R5990:Muc16	UTSW	9	18659243	missense	unknown
R6024:Muc16	UTSW	9	18646671	missense	unknown
R6026:Muc16	UTSW	9	18659858	missense	unknown
R6028:Muc16	UTSW	9	18657176	missense	unknown
R6083:Muc16	UTSW	9	18657212	missense	unknown
R6089:Muc16	UTSW	9	18643252	missense	unknown
R6109:Muc16	UTSW	9	18655359	missense	unknown
R6127:Muc16	UTSW	9	18657878	missense	unknown
R6130:Muc16	UTSW	9	18590698	missense	probably damaging	1.00
R6146:Muc16	UTSW	9	18497797	missense	probably damaging	0.98
R6161:Muc16	UTSW	9	18647818	missense	unknown
R6164:Muc16	UTSW	9	18558379	missense	probably damaging	1.00
R6185:Muc16	UTSW	9	18654473	missense	unknown
R6192:Muc16	UTSW	9	18658689	missense	unknown
R6217:Muc16	UTSW	9	18655446	missense	unknown
R6232:Muc16	UTSW	9	18656998	missense	unknown
R6246:Muc16	UTSW	9	18577067	intron	probably null
R6255:Muc16	UTSW	9	18655599	missense	unknown
R6280:Muc16	UTSW	9	18579317	critical splice donor site	probably null
R6286:Muc16	UTSW	9	18644389	missense	unknown
R6287:Muc16	UTSW	9	18659034	missense	unknown
R6307:Muc16	UTSW	9	18647588	missense	unknown
R6310:Muc16	UTSW	9	18641950	missense	probably benign	0.00
R6316:Muc16	UTSW	9	18641819	missense	probably benign	0.01
R6335:Muc16	UTSW	9	18660708	missense	unknown
R6345:Muc16	UTSW	9	18654926	missense	unknown
R6349:Muc16	UTSW	9	18657329	missense	unknown
R6366:Muc16	UTSW	9	18646044	missense	unknown
R6393:Muc16	UTSW	9	18647399	nonsense	probably null
R6440:Muc16	UTSW	9	18641359	missense	probably benign	0.01
R6458:Muc16	UTSW	9	18641721	missense	probably benign	0.01
R6460:Muc16	UTSW	9	18640516	missense	probably benign	0.01
R6481:Muc16	UTSW	9	18550677	critical splice donor site	probably null
R6539:Muc16	UTSW	9	18637325	missense	probably benign	0.25
R6551:Muc16	UTSW	9	18562562	missense	possibly damaging	0.95
R6596:Muc16	UTSW	9	18566715	missense	probably benign	0.18
R6601:Muc16	UTSW	9	18637570	missense	probably benign	0.10
R6602:Muc16	UTSW	9	18609476	intron	probably null
R6615:Muc16	UTSW	9	18647188	missense	unknown
R6625:Muc16	UTSW	9	18660278	missense	unknown
R6668:Muc16	UTSW	9	18640385	missense	probably benign	0.03
R6697:Muc16	UTSW	9	18641291	missense	probably benign	0.01
R6710:Muc16	UTSW	9	18642070	missense	possibly damaging	0.95
R6727:Muc16	UTSW	9	18566690	critical splice donor site	probably null
R6789:Muc16	UTSW	9	18559986	missense	probably benign	0.40
R6806:Muc16	UTSW	9	18537910	critical splice donor site	probably null
R6874:Muc16	UTSW	9	18658769	nonsense	probably null
R6894:Muc16	UTSW	9	18495576	missense	possibly damaging	0.92
R6913:Muc16	UTSW	9	18642663	missense	unknown
R6919:Muc16	UTSW	9	18660299	missense	unknown
R6939:Muc16	UTSW	9	18638537	missense	probably benign	0.04
R6953:Muc16	UTSW	9	18640529	missense	probably benign	0.01
R6956:Muc16	UTSW	9	18645026	missense	unknown
R6977:Muc16	UTSW	9	18645337	missense	unknown
R6996:Muc16	UTSW	9	18645897	missense	unknown
R7011:Muc16	UTSW	9	18637451	missense	probably benign	0.26
R7011:Muc16	UTSW	9	18637543	missense	probably benign	0.10
R7012:Muc16	UTSW	9	18495618	critical splice acceptor site	probably null
R7014:Muc16	UTSW	9	18658236	missense	unknown
R7021:Muc16	UTSW	9	18554919	missense	unknown
R7021:Muc16	UTSW	9	18550831	splice site	probably null
R7038:Muc16	UTSW	9	18620468	missense	probably damaging	0.99
R7057:Muc16	UTSW	9	18646079	missense	unknown
R7058:Muc16	UTSW	9	18639755	missense	probably benign	0.10
R7066:Muc16	UTSW	9	18658021	missense	unknown
R7067:Muc16	UTSW	9	18658251	missense	unknown
R7070:Muc16	UTSW	9	18645923	nonsense	probably null
R7074:Muc16	UTSW	9	18655650	missense	unknown
R7085:Muc16	UTSW	9	18644849	missense	unknown
R7088:Muc16	UTSW	9	18592680	missense	probably damaging	0.99
R7107:Muc16	UTSW	9	18637298	missense	probably benign	0.10
R7108:Muc16	UTSW	9	18655233	missense	unknown
R7128:Muc16	UTSW	9	18643004	missense	unknown
R7145:Muc16	UTSW	9	18655580	missense	unknown
R7179:Muc16	UTSW	9	18642008	missense	probably benign	0.00
R7194:Muc16	UTSW	9	18674454	missense	unknown
R7211:Muc16	UTSW	9	18498570	missense	probably damaging	1.00
R7213:Muc16	UTSW	9	18641416	missense	probably benign	0.01
R7217:Muc16	UTSW	9	18644076	nonsense	probably null
R7221:Muc16	UTSW	9	18642199	missense	probably benign	0.04
R7265:Muc16	UTSW	9	18656472	missense	unknown
R7326:Muc16	UTSW	9	18585013	missense	probably benign	0.03
R7359:Muc16	UTSW	9	18643020	missense	unknown
R7387:Muc16	UTSW	9	18641720	missense	probably benign	0.01
R7391:Muc16	UTSW	9	18639536	missense	probably benign	0.04
R7398:Muc16	UTSW	9	18637742	missense	possibly damaging	0.46
R7419:Muc16	UTSW	9	18641962	missense	probably benign	0.01
R7431:Muc16	UTSW	9	18607993	missense
R7484:Muc16	UTSW	9	18646768	missense	unknown
R7487:Muc16	UTSW	9	18584799	missense	possibly damaging	0.93
R7497:Muc16	UTSW	9	18645089	missense	unknown
R7515:Muc16	UTSW	9	18639662	missense	probably benign	0.00
R7537:Muc16	UTSW	9	18638135	missense	probably benign	0.06
R7538:Muc16	UTSW	9	18642131	missense	probably benign	0.10
R7538:Muc16	UTSW	9	18655451	missense	unknown
R7543:Muc16	UTSW	9	18644732	missense	unknown
R7566:Muc16	UTSW	9	18638629	missense	probably benign	0.00
R7581:Muc16	UTSW	9	18645614	missense	unknown
R7594:Muc16	UTSW	9	18645062	missense	unknown
R7629:Muc16	UTSW	9	18566785	missense	possibly damaging	0.86
R7664:Muc16	UTSW	9	18607722	missense	probably benign	0.08
R7666:Muc16	UTSW	9	18558427	missense	probably damaging	1.00
R7703:Muc16	UTSW	9	18605282	missense
R7727:Muc16	UTSW	9	18660242	missense	unknown
R7743:Muc16	UTSW	9	18657477	missense	unknown
R7744:Muc16	UTSW	9	18585096	critical splice acceptor site	probably null
R7761:Muc16	UTSW	9	18580574	missense	probably damaging	1.00
R7769:Muc16	UTSW	9	18660507	missense	unknown
R7805:Muc16	UTSW	9	18638493	missense	possibly damaging	0.94
R7827:Muc16	UTSW	9	18595223	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- GGAGCACTGGTTGAGATTACTG -3'
(R):5'- TGACCTCACCAACAGTTATTCC -3'

Sequencing Primer
(F):5'- CTGTAGATACAGTCCCTGAAGTGC -3'
(R):5'- AAGTTCCATTAGTCACCCATGTTGTG -3'

Posted On

2019-05-15