Incidental Mutation 'R7126:Olfr1355'
ID552337
Institutional Source Beutler Lab
Gene Symbol Olfr1355
Ensembl Gene ENSMUSG00000062873
Gene Nameolfactory receptor 1355
SynonymsGA_x6K02T2QGN0-2932609-2931677, MOR139-6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R7126 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location78875540-78882266 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78879577 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 135 (V135A)
Ref Sequence ENSEMBL: ENSMUSP00000077517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078414]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078414
AA Change: V135A

PolyPhen 2 Score 0.497 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000077517
Gene: ENSMUSG00000062873
AA Change: V135A

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 3.1e-48 PFAM
Pfam:7tm_1 42 291 1.1e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik C T 17: 23,720,564 V8I probably benign Het
1810062G17Rik T C 3: 36,481,839 C85R unknown Het
3110082I17Rik G T 5: 139,361,250 H153Q unknown Het
Acadsb T C 7: 131,437,448 I316T probably benign Het
Acsbg2 A T 17: 56,846,633 N523K probably damaging Het
Ahnak C T 19: 9,002,359 P336S possibly damaging Het
Ankdd1b A G 13: 96,429,862 V277A possibly damaging Het
Aspm A G 1: 139,480,803 Y2476C probably benign Het
Atg13 G A 2: 91,680,420 R321W probably damaging Het
B4galt2 A G 4: 117,877,538 F211S probably damaging Het
Baiap3 T A 17: 25,245,145 T913S possibly damaging Het
Btbd18 A T 2: 84,666,202 E61D possibly damaging Het
Btnl9 G T 11: 49,169,255 S555R probably damaging Het
Cbs T A 17: 31,619,139 M379L probably benign Het
Chd9 G A 8: 91,015,225 G1614D unknown Het
Cmya5 G A 13: 93,089,940 P2880L probably benign Het
Cnnm1 T C 19: 43,484,853 S729P probably damaging Het
Cox16 T A 12: 81,472,166 E70D probably benign Het
Cp A G 3: 19,980,624 H699R probably damaging Het
Cyp2d26 T C 15: 82,794,008 N56D probably benign Het
Dennd4c A G 4: 86,807,430 Y707C probably damaging Het
Dgcr14 T C 16: 17,911,290 T6A unknown Het
Dnah5 A T 15: 28,349,837 E2555D probably benign Het
Fam129a T A 1: 151,714,567 C537* probably null Het
Filip1 A G 9: 79,898,295 L59P possibly damaging Het
Fsip2 A G 2: 82,983,141 N3268S possibly damaging Het
Gja10 A T 4: 32,601,014 C457S probably benign Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 101,794,171 probably benign Het
Gm47959 G A 1: 83,000,782 G57S unknown Het
Gm4869 A T 5: 140,491,318 D874V probably benign Het
Grid2 T A 6: 64,076,810 V331E probably damaging Het
Inpp4a C A 1: 37,374,272 H123Q probably benign Het
Ireb2 T A 9: 54,886,567 Y260* probably null Het
Itpr2 G A 6: 146,357,796 Q628* probably null Het
Kbtbd11 G A 8: 15,028,759 A453T probably damaging Het
Kcnj2 A G 11: 111,072,822 T347A probably damaging Het
Klhl12 A G 1: 134,467,783 H161R probably damaging Het
Krt78 T C 15: 101,948,436 E412G probably damaging Het
Lzic A G 4: 149,488,675 I95V probably damaging Het
Mme C T 3: 63,368,901 P700S probably damaging Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Mthfd2 A G 6: 83,313,490 V53A probably benign Het
Mtus1 A G 8: 41,015,402 L210P probably damaging Het
Muc16 T C 9: 18,641,216 T4594A probably benign Het
Olfm5 A T 7: 104,159,980 C208S probably damaging Het
Olfr1368 A T 13: 21,142,718 L113H probably damaging Het
Olfr1494 T A 19: 13,749,523 I139N possibly damaging Het
Parp12 T C 6: 39,111,736 I189V probably benign Het
Plin1 T C 7: 79,726,664 probably null Het
Prl7a1 C T 13: 27,642,419 probably null Het
Ptpn23 T C 9: 110,388,744 D711G probably benign Het
Rgs22 A T 15: 36,103,808 I169N probably damaging Het
Scn7a G T 2: 66,757,286 H24Q possibly damaging Het
Scrt2 C T 2: 152,093,086 P53L probably damaging Het
Sh3rf1 A T 8: 61,349,424 I264L probably benign Het
Smarcd1 A T 15: 99,709,325 D393V probably damaging Het
Spag17 T G 3: 100,101,435 N1960K probably benign Het
Ssb A G 2: 69,866,501 T62A possibly damaging Het
Taar7b T A 10: 24,000,062 Y42N possibly damaging Het
Terf1 A T 1: 15,813,139 I159L probably benign Het
Tff3 T G 17: 31,127,436 N54T probably benign Het
Top2a A G 11: 99,014,992 L285P probably benign Het
Trim24 A G 6: 37,919,457 Y283C probably damaging Het
Trim58 T C 11: 58,640,579 C38R probably damaging Het
Trpa1 T A 1: 14,890,424 T647S probably benign Het
Trpm4 A T 7: 45,310,709 probably null Het
Trpm6 C T 19: 18,854,033 Q1421* probably null Het
Ubr2 A T 17: 46,974,056 probably null Het
Vmn1r46 T G 6: 89,976,994 I275S possibly damaging Het
Vmn2r54 A G 7: 12,632,161 F282S possibly damaging Het
Vmn2r57 A G 7: 41,399,794 S844P possibly damaging Het
Vps13a A C 19: 16,710,879 C855G probably benign Het
Wdr31 T A 4: 62,463,429 Q55L probably benign Het
Other mutations in Olfr1355
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01571:Olfr1355 APN 10 78879837 missense possibly damaging 0.95
IGL01773:Olfr1355 APN 10 78879936 missense possibly damaging 0.86
IGL02707:Olfr1355 APN 10 78879925 missense probably damaging 1.00
IGL03233:Olfr1355 APN 10 78879572 nonsense probably null
R1067:Olfr1355 UTSW 10 78879683 nonsense probably null
R1201:Olfr1355 UTSW 10 78879477 missense probably benign 0.12
R1956:Olfr1355 UTSW 10 78879433 missense probably benign 0.28
R1978:Olfr1355 UTSW 10 78879280 missense probably damaging 1.00
R2014:Olfr1355 UTSW 10 78879388 missense possibly damaging 0.94
R2015:Olfr1355 UTSW 10 78879388 missense possibly damaging 0.94
R2245:Olfr1355 UTSW 10 78879931 missense probably damaging 0.98
R3725:Olfr1355 UTSW 10 78879932 nonsense probably null
R4899:Olfr1355 UTSW 10 78879207 missense probably benign 0.32
R5696:Olfr1355 UTSW 10 78880085 missense probably benign 0.02
R5982:Olfr1355 UTSW 10 78879953 nonsense probably null
R6448:Olfr1355 UTSW 10 78879682 missense possibly damaging 0.78
R7385:Olfr1355 UTSW 10 78879454 missense probably damaging 0.97
R7807:Olfr1355 UTSW 10 78879209 missense probably benign
R7886:Olfr1355 UTSW 10 78879823 missense possibly damaging 0.59
R7969:Olfr1355 UTSW 10 78879823 missense possibly damaging 0.59
Z1177:Olfr1355 UTSW 10 78879156 critical splice acceptor site probably null
Z1177:Olfr1355 UTSW 10 78879559 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- CCACTGTCCCAAAGATGCTG -3'
(R):5'- AATGGCTCCCAATAGAACAGGTAC -3'

Sequencing Primer
(F):5'- GTCCCAAAGATGCTGGTAAATATAC -3'
(R):5'- CTTGATAAGCTGTCTGAACATGTGAG -3'
Posted On2019-05-15