Incidental Mutation 'R0599:Mon2'
ID 55234
Institutional Source Beutler Lab
Gene Symbol Mon2
Ensembl Gene ENSMUSG00000034602
Gene Name MON2 homolog, regulator of endosome to Golgi trafficking
Synonyms 2610528O22Rik, SF21
MMRRC Submission 038788-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.856) question?
Stock # R0599 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 122992060-123076505 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 123026065 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037557] [ENSMUST00000037557] [ENSMUST00000037557] [ENSMUST00000037557] [ENSMUST00000073792] [ENSMUST00000073792] [ENSMUST00000073792] [ENSMUST00000073792] [ENSMUST00000170935] [ENSMUST00000170935] [ENSMUST00000170935] [ENSMUST00000170935]
AlphaFold Q80TL7
Predicted Effect probably benign
Transcript: ENSMUST00000037557
SMART Domains Protein: ENSMUSP00000037568
Gene: ENSMUSG00000034602

DomainStartEndE-ValueType
low complexity region 119 138 N/A INTRINSIC
low complexity region 164 176 N/A INTRINSIC
Pfam:Sec7_N 208 294 6.5e-16 PFAM
Pfam:Sec7_N 299 385 2.6e-16 PFAM
low complexity region 405 438 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
low complexity region 615 627 N/A INTRINSIC
Pfam:DUF1981 844 929 2.4e-21 PFAM
low complexity region 984 1001 N/A INTRINSIC
low complexity region 1182 1193 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000037557
SMART Domains Protein: ENSMUSP00000037568
Gene: ENSMUSG00000034602

DomainStartEndE-ValueType
low complexity region 119 138 N/A INTRINSIC
low complexity region 164 176 N/A INTRINSIC
Pfam:Sec7_N 208 294 6.5e-16 PFAM
Pfam:Sec7_N 299 385 2.6e-16 PFAM
low complexity region 405 438 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
low complexity region 615 627 N/A INTRINSIC
Pfam:DUF1981 844 929 2.4e-21 PFAM
low complexity region 984 1001 N/A INTRINSIC
low complexity region 1182 1193 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000037557
SMART Domains Protein: ENSMUSP00000037568
Gene: ENSMUSG00000034602

DomainStartEndE-ValueType
low complexity region 119 138 N/A INTRINSIC
low complexity region 164 176 N/A INTRINSIC
Pfam:Sec7_N 208 294 6.5e-16 PFAM
Pfam:Sec7_N 299 385 2.6e-16 PFAM
low complexity region 405 438 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
low complexity region 615 627 N/A INTRINSIC
Pfam:DUF1981 844 929 2.4e-21 PFAM
low complexity region 984 1001 N/A INTRINSIC
low complexity region 1182 1193 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000037557
SMART Domains Protein: ENSMUSP00000037568
Gene: ENSMUSG00000034602

DomainStartEndE-ValueType
low complexity region 119 138 N/A INTRINSIC
low complexity region 164 176 N/A INTRINSIC
Pfam:Sec7_N 208 294 6.5e-16 PFAM
Pfam:Sec7_N 299 385 2.6e-16 PFAM
low complexity region 405 438 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
low complexity region 615 627 N/A INTRINSIC
Pfam:DUF1981 844 929 2.4e-21 PFAM
low complexity region 984 1001 N/A INTRINSIC
low complexity region 1182 1193 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073792
SMART Domains Protein: ENSMUSP00000073462
Gene: ENSMUSG00000034602

DomainStartEndE-ValueType
Pfam:DCB 8 184 3e-72 PFAM
Pfam:Sec7_N 211 384 3.1e-58 PFAM
low complexity region 405 438 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
low complexity region 615 627 N/A INTRINSIC
Pfam:DUF1981 848 929 6.6e-20 PFAM
Pfam:Mon2_C 932 1706 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073792
SMART Domains Protein: ENSMUSP00000073462
Gene: ENSMUSG00000034602

DomainStartEndE-ValueType
Pfam:DCB 8 184 3e-72 PFAM
Pfam:Sec7_N 211 384 3.1e-58 PFAM
low complexity region 405 438 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
low complexity region 615 627 N/A INTRINSIC
Pfam:DUF1981 848 929 6.6e-20 PFAM
Pfam:Mon2_C 932 1706 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073792
SMART Domains Protein: ENSMUSP00000073462
Gene: ENSMUSG00000034602

DomainStartEndE-ValueType
Pfam:DCB 8 184 3e-72 PFAM
Pfam:Sec7_N 211 384 3.1e-58 PFAM
low complexity region 405 438 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
low complexity region 615 627 N/A INTRINSIC
Pfam:DUF1981 848 929 6.6e-20 PFAM
Pfam:Mon2_C 932 1706 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073792
SMART Domains Protein: ENSMUSP00000073462
Gene: ENSMUSG00000034602

DomainStartEndE-ValueType
Pfam:DCB 8 184 3e-72 PFAM
Pfam:Sec7_N 211 384 3.1e-58 PFAM
low complexity region 405 438 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
low complexity region 615 627 N/A INTRINSIC
Pfam:DUF1981 848 929 6.6e-20 PFAM
Pfam:Mon2_C 932 1706 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170935
SMART Domains Protein: ENSMUSP00000131052
Gene: ENSMUSG00000034602

DomainStartEndE-ValueType
low complexity region 119 138 N/A INTRINSIC
low complexity region 164 176 N/A INTRINSIC
Pfam:Sec7_N 208 294 6.5e-16 PFAM
Pfam:Sec7_N 299 385 2.6e-16 PFAM
low complexity region 405 438 N/A INTRINSIC
low complexity region 559 576 N/A INTRINSIC
low complexity region 616 628 N/A INTRINSIC
Pfam:DUF1981 845 930 8.1e-22 PFAM
low complexity region 985 1002 N/A INTRINSIC
low complexity region 1183 1194 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170935
SMART Domains Protein: ENSMUSP00000131052
Gene: ENSMUSG00000034602

DomainStartEndE-ValueType
low complexity region 119 138 N/A INTRINSIC
low complexity region 164 176 N/A INTRINSIC
Pfam:Sec7_N 208 294 6.5e-16 PFAM
Pfam:Sec7_N 299 385 2.6e-16 PFAM
low complexity region 405 438 N/A INTRINSIC
low complexity region 559 576 N/A INTRINSIC
low complexity region 616 628 N/A INTRINSIC
Pfam:DUF1981 845 930 8.1e-22 PFAM
low complexity region 985 1002 N/A INTRINSIC
low complexity region 1183 1194 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170935
SMART Domains Protein: ENSMUSP00000131052
Gene: ENSMUSG00000034602

DomainStartEndE-ValueType
low complexity region 119 138 N/A INTRINSIC
low complexity region 164 176 N/A INTRINSIC
Pfam:Sec7_N 208 294 6.5e-16 PFAM
Pfam:Sec7_N 299 385 2.6e-16 PFAM
low complexity region 405 438 N/A INTRINSIC
low complexity region 559 576 N/A INTRINSIC
low complexity region 616 628 N/A INTRINSIC
Pfam:DUF1981 845 930 8.1e-22 PFAM
low complexity region 985 1002 N/A INTRINSIC
low complexity region 1183 1194 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170935
SMART Domains Protein: ENSMUSP00000131052
Gene: ENSMUSG00000034602

DomainStartEndE-ValueType
low complexity region 119 138 N/A INTRINSIC
low complexity region 164 176 N/A INTRINSIC
Pfam:Sec7_N 208 294 6.5e-16 PFAM
Pfam:Sec7_N 299 385 2.6e-16 PFAM
low complexity region 405 438 N/A INTRINSIC
low complexity region 559 576 N/A INTRINSIC
low complexity region 616 628 N/A INTRINSIC
Pfam:DUF1981 845 930 8.1e-22 PFAM
low complexity region 985 1002 N/A INTRINSIC
low complexity region 1183 1194 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219001
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222536
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 98% (80/82)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,552,245 L978P probably damaging Het
Abcb1a C T 5: 8,698,539 T290M probably benign Het
Abcd3 A T 3: 121,765,093 F585I probably damaging Het
Acan A G 7: 79,111,290 probably benign Het
Anxa6 T C 11: 54,979,466 D667G possibly damaging Het
Ap3m2 G T 8: 22,793,112 A208D possibly damaging Het
Arhgap17 A T 7: 123,303,790 probably benign Het
Bptf A G 11: 107,068,382 V1838A probably damaging Het
Brip1 T A 11: 86,152,737 M334L probably benign Het
Btbd10 C T 7: 113,335,309 probably benign Het
Btbd11 G A 10: 85,658,336 G1106D probably damaging Het
Cdh7 C A 1: 110,052,966 T208K probably damaging Het
Cnga4 A G 7: 105,405,818 Y100C probably damaging Het
Dnah10 G A 5: 124,800,953 V2644M probably damaging Het
Dnah9 T C 11: 65,965,689 D2882G probably damaging Het
Eapp T A 12: 54,685,962 K117M probably damaging Het
Eml3 T C 19: 8,939,063 V673A probably benign Het
Ephb4 G A 5: 137,369,855 C754Y probably damaging Het
Eps8l1 A G 7: 4,477,957 D33G possibly damaging Het
Farsa A G 8: 84,867,583 K321E probably damaging Het
Fry G A 5: 150,437,159 R2090Q probably damaging Het
Gm10283 A G 8: 60,501,224 probably benign Het
Grm4 A G 17: 27,431,490 I844T probably benign Het
Gtf2h3 A G 5: 124,588,628 D124G probably benign Het
Gulo A T 14: 65,990,441 D347E probably damaging Het
Hmcn1 A G 1: 150,609,801 F4350S possibly damaging Het
Hspg2 A G 4: 137,512,401 D473G probably damaging Het
Il17ra T A 6: 120,481,505 I539N probably damaging Het
Insrr A G 3: 87,813,133 E1026G probably damaging Het
Itga2 A T 13: 114,856,650 probably benign Het
Kdm1b A T 13: 47,058,810 D190V possibly damaging Het
Lima1 A T 15: 99,802,159 N146K probably damaging Het
Mettl7a3 A T 15: 100,335,383 N152Y possibly damaging Het
Mnt G T 11: 74,842,296 V85L probably benign Het
Mtf1 T C 4: 124,820,201 probably benign Het
Mylk4 T C 13: 32,712,754 probably null Het
Myo18b A C 5: 112,865,750 L780R probably damaging Het
Myo1e A G 9: 70,376,660 probably benign Het
Obscn A G 11: 59,073,696 S705P probably damaging Het
Ocrl A T X: 47,936,086 probably benign Het
Olfr1260 T C 2: 89,978,201 F141S probably benign Het
Olfr394 A T 11: 73,887,904 M156K probably benign Het
Olfr599 A G 7: 103,338,186 N44S probably damaging Het
Olfr639 A T 7: 104,012,188 C171* probably null Het
Otof T A 5: 30,370,705 K1931N probably damaging Het
Plcxd3 A G 15: 4,516,867 S118G probably damaging Het
Plcz1 T A 6: 140,028,542 Q58L probably benign Het
Proser1 C A 3: 53,479,064 P789Q probably benign Het
Rassf4 T C 6: 116,645,936 E38G probably damaging Het
Ros1 A T 10: 52,123,300 Y1164N probably damaging Het
Rpgrip1l A G 8: 91,305,000 I83T probably damaging Het
Scn9a T G 2: 66,526,799 K1053Q probably damaging Het
Sgsm1 G T 5: 113,245,028 Q1087K probably damaging Het
Slc16a10 T C 10: 40,141,918 D40G probably benign Het
Slc27a6 A G 18: 58,556,813 D117G probably damaging Het
Slc2a9 T A 5: 38,480,144 probably benign Het
Slc4a1 A G 11: 102,357,915 probably benign Het
Smarca1 T A X: 47,823,426 Q982L probably benign Het
Sp100 T A 1: 85,681,110 I320N possibly damaging Het
Stx8 A T 11: 68,109,362 R209S probably null Het
Sulf2 T C 2: 166,083,879 T453A possibly damaging Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tenm2 T A 11: 36,024,780 I1976F possibly damaging Het
Tenm3 G A 8: 48,277,710 S1341L probably damaging Het
Tmem130 C T 5: 144,737,809 V369M probably damaging Het
Tmem200c A G 17: 68,840,511 K30E probably damaging Het
Tmem225 A G 9: 40,149,747 I117V possibly damaging Het
Top2a A G 11: 99,001,417 I1073T probably damaging Het
Trps1 A C 15: 50,831,860 Y296* probably null Het
Tubg1 T C 11: 101,125,336 M377T probably benign Het
Vmn1r35 G A 6: 66,679,513 H58Y probably benign Het
Vmn1r56 G A 7: 5,196,430 H63Y probably benign Het
Vmn1r75 T C 7: 11,881,262 probably null Het
Vnn3 T C 10: 23,865,705 S303P possibly damaging Het
Wdr49 C T 3: 75,431,076 probably null Het
Wdr49 T C 3: 75,449,890 probably null Het
Zcchc6 A G 13: 59,809,487 V7A probably damaging Het
Zzef1 T C 11: 72,913,178 L2582P probably damaging Het
Other mutations in Mon2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Mon2 APN 10 123026299 missense probably damaging 1.00
IGL01072:Mon2 APN 10 123010539 nonsense probably null
IGL02080:Mon2 APN 10 123052190 missense probably damaging 0.98
IGL02157:Mon2 APN 10 123013472 missense probably damaging 1.00
IGL02419:Mon2 APN 10 123016447 missense probably benign 0.05
IGL02498:Mon2 APN 10 123034330 missense probably benign 0.00
IGL02638:Mon2 APN 10 123023939 missense probably damaging 1.00
IGL02664:Mon2 APN 10 123009496 splice site probably benign
IGL02690:Mon2 APN 10 123009627 missense possibly damaging 0.67
IGL02878:Mon2 APN 10 123006991 missense probably benign 0.09
IGL03092:Mon2 APN 10 123018100 missense probably damaging 1.00
IGL03103:Mon2 APN 10 123030103 splice site probably benign
IGL03208:Mon2 APN 10 123018069 splice site probably benign
R0010:Mon2 UTSW 10 123032694 missense probably damaging 1.00
R0016:Mon2 UTSW 10 123035546 missense probably damaging 0.96
R0016:Mon2 UTSW 10 123035546 missense probably damaging 0.96
R0027:Mon2 UTSW 10 123036048 missense possibly damaging 0.66
R0027:Mon2 UTSW 10 123036048 missense possibly damaging 0.66
R0145:Mon2 UTSW 10 123013512 missense possibly damaging 0.94
R0390:Mon2 UTSW 10 123007021 missense probably null 0.05
R0481:Mon2 UTSW 10 123013396 missense possibly damaging 0.94
R0513:Mon2 UTSW 10 123038610 missense probably damaging 1.00
R1226:Mon2 UTSW 10 123002819 missense probably benign 0.17
R1548:Mon2 UTSW 10 123036007 splice site probably benign
R1598:Mon2 UTSW 10 123016396 missense probably damaging 1.00
R1650:Mon2 UTSW 10 122995777 missense probably benign 0.45
R1687:Mon2 UTSW 10 123026124 missense probably damaging 0.98
R1721:Mon2 UTSW 10 123031097 missense probably damaging 0.98
R1768:Mon2 UTSW 10 123013763 missense probably benign 0.00
R1827:Mon2 UTSW 10 123046311 missense probably damaging 0.97
R1879:Mon2 UTSW 10 123002885 missense probably damaging 1.00
R1954:Mon2 UTSW 10 123038483 missense probably damaging 1.00
R1955:Mon2 UTSW 10 123038483 missense probably damaging 1.00
R1968:Mon2 UTSW 10 123009565 missense probably damaging 1.00
R2060:Mon2 UTSW 10 122995776 missense probably damaging 1.00
R2160:Mon2 UTSW 10 123075929 nonsense probably null
R2165:Mon2 UTSW 10 123042364 splice site probably null
R3737:Mon2 UTSW 10 123013375 missense probably damaging 1.00
R3814:Mon2 UTSW 10 123013565 missense probably damaging 0.98
R4058:Mon2 UTSW 10 123002819 missense probably benign 0.17
R4091:Mon2 UTSW 10 123038510 missense probably damaging 1.00
R4214:Mon2 UTSW 10 123016492 missense probably benign 0.03
R4354:Mon2 UTSW 10 123026983 missense probably benign 0.02
R4422:Mon2 UTSW 10 123042982 missense probably damaging 1.00
R4505:Mon2 UTSW 10 123009589 missense probably damaging 0.99
R4791:Mon2 UTSW 10 123006057 missense probably benign 0.01
R4797:Mon2 UTSW 10 123016517 missense probably benign 0.45
R4944:Mon2 UTSW 10 123038459 critical splice donor site probably null
R4982:Mon2 UTSW 10 122995789 missense probably damaging 1.00
R5298:Mon2 UTSW 10 123010606 missense probably benign
R5503:Mon2 UTSW 10 123032645 missense possibly damaging 0.54
R5653:Mon2 UTSW 10 123026094 missense probably damaging 0.96
R5687:Mon2 UTSW 10 123008239 missense probably damaging 0.99
R5838:Mon2 UTSW 10 123010492 critical splice donor site probably null
R6108:Mon2 UTSW 10 123032695 missense probably benign 0.00
R6182:Mon2 UTSW 10 123038659 splice site probably null
R6355:Mon2 UTSW 10 123022920 missense possibly damaging 0.58
R6358:Mon2 UTSW 10 123013504 missense probably damaging 0.98
R6548:Mon2 UTSW 10 123036093 missense probably damaging 1.00
R6557:Mon2 UTSW 10 123016402 missense probably damaging 1.00
R6649:Mon2 UTSW 10 123038480 missense possibly damaging 0.46
R7140:Mon2 UTSW 10 123035453 missense probably benign 0.00
R7303:Mon2 UTSW 10 123038459 critical splice donor site probably null
R7317:Mon2 UTSW 10 123013946 missense probably damaging 0.97
R7355:Mon2 UTSW 10 123009516 missense probably benign
R7508:Mon2 UTSW 10 123023939 missense probably damaging 1.00
R7509:Mon2 UTSW 10 123032552 missense probably benign
R7647:Mon2 UTSW 10 123006026 missense probably benign
R7720:Mon2 UTSW 10 123032588 missense probably benign 0.00
R7799:Mon2 UTSW 10 123042331 missense probably benign 0.41
R7801:Mon2 UTSW 10 123059186 critical splice donor site probably null
R7823:Mon2 UTSW 10 123032654 missense probably damaging 1.00
R7985:Mon2 UTSW 10 123016308 missense probably damaging 1.00
R8310:Mon2 UTSW 10 123002783 missense probably damaging 1.00
R8810:Mon2 UTSW 10 123009611 missense possibly damaging 0.94
R8825:Mon2 UTSW 10 123013871 missense probably benign 0.00
R8937:Mon2 UTSW 10 123059205 missense probably benign
R8978:Mon2 UTSW 10 123035564 nonsense probably null
R9011:Mon2 UTSW 10 123026308 missense possibly damaging 0.95
R9213:Mon2 UTSW 10 123036111 nonsense probably null
R9358:Mon2 UTSW 10 123032547 missense probably benign 0.00
X0022:Mon2 UTSW 10 123006102 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TGACAGCTCCGTATAAAAGCCGTG -3'
(R):5'- GACTTGCCAGTGATCTCCAACATCC -3'

Sequencing Primer
(F):5'- GCATGTAAGAAAGAAGGGACATAAC -3'
(R):5'- GTTTGAAAGCTCACAGTAAGTCCC -3'
Posted On 2013-07-11