Incidental Mutation 'R7126:Cbs'
ID552356
Institutional Source Beutler Lab
Gene Symbol Cbs
Ensembl Gene ENSMUSG00000024039
Gene Namecystathionine beta-synthase
SynonymsHIP4
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.734) question?
Stock #R7126 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location31612623-31637199 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31619139 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 379 (M379L)
Ref Sequence ENSEMBL: ENSMUSP00000066878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067801] [ENSMUST00000078509] [ENSMUST00000118504]
Predicted Effect probably benign
Transcript: ENSMUST00000067801
AA Change: M379L

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000066878
Gene: ENSMUSG00000024039
AA Change: M379L

DomainStartEndE-ValueType
Pfam:PALP 77 373 3.7e-66 PFAM
CBS 417 465 5.9e-11 SMART
Blast:CBS 482 553 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000078509
AA Change: M379L

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000077597
Gene: ENSMUSG00000024039
AA Change: M379L

DomainStartEndE-ValueType
Pfam:PALP 77 373 3.4e-64 PFAM
CBS 417 465 1.19e-8 SMART
Blast:CBS 483 539 2e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000118504
AA Change: M379L

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113209
Gene: ENSMUSG00000024039
AA Change: M379L

DomainStartEndE-ValueType
Pfam:PALP 77 373 3.4e-64 PFAM
CBS 417 465 1.19e-8 SMART
Blast:CBS 483 539 2e-11 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (73/75)
MGI Phenotype PHENOTYPE: Homozygous targeted mutants are severely growth retarded and die within 5 weeks of birth with enlarged multinucleate hepatocytes filled with lipid and massively elevated plasma homocysteine levels. Heterozygotes have twice normal homocysteine levels, butsurvive and breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik C T 17: 23,720,564 V8I probably benign Het
1810062G17Rik T C 3: 36,481,839 C85R unknown Het
3110082I17Rik G T 5: 139,361,250 H153Q unknown Het
Acadsb T C 7: 131,437,448 I316T probably benign Het
Acsbg2 A T 17: 56,846,633 N523K probably damaging Het
Ahnak C T 19: 9,002,359 P336S possibly damaging Het
Ankdd1b A G 13: 96,429,862 V277A possibly damaging Het
Aspm A G 1: 139,480,803 Y2476C probably benign Het
Atg13 G A 2: 91,680,420 R321W probably damaging Het
B4galt2 A G 4: 117,877,538 F211S probably damaging Het
Baiap3 T A 17: 25,245,145 T913S possibly damaging Het
Btbd18 A T 2: 84,666,202 E61D possibly damaging Het
Btnl9 G T 11: 49,169,255 S555R probably damaging Het
Chd9 G A 8: 91,015,225 G1614D unknown Het
Cmya5 G A 13: 93,089,940 P2880L probably benign Het
Cnnm1 T C 19: 43,484,853 S729P probably damaging Het
Cox16 T A 12: 81,472,166 E70D probably benign Het
Cp A G 3: 19,980,624 H699R probably damaging Het
Cyp2d26 T C 15: 82,794,008 N56D probably benign Het
Dennd4c A G 4: 86,807,430 Y707C probably damaging Het
Dgcr14 T C 16: 17,911,290 T6A unknown Het
Dnah5 A T 15: 28,349,837 E2555D probably benign Het
Fam129a T A 1: 151,714,567 C537* probably null Het
Filip1 A G 9: 79,898,295 L59P possibly damaging Het
Fsip2 A G 2: 82,983,141 N3268S possibly damaging Het
Gja10 A T 4: 32,601,014 C457S probably benign Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 101,794,171 probably benign Het
Gm47959 G A 1: 83,000,782 G57S unknown Het
Gm4869 A T 5: 140,491,318 D874V probably benign Het
Grid2 T A 6: 64,076,810 V331E probably damaging Het
Inpp4a C A 1: 37,374,272 H123Q probably benign Het
Ireb2 T A 9: 54,886,567 Y260* probably null Het
Itpr2 G A 6: 146,357,796 Q628* probably null Het
Kbtbd11 G A 8: 15,028,759 A453T probably damaging Het
Kcnj2 A G 11: 111,072,822 T347A probably damaging Het
Klhl12 A G 1: 134,467,783 H161R probably damaging Het
Krt78 T C 15: 101,948,436 E412G probably damaging Het
Lzic A G 4: 149,488,675 I95V probably damaging Het
Mme C T 3: 63,368,901 P700S probably damaging Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Mthfd2 A G 6: 83,313,490 V53A probably benign Het
Mtus1 A G 8: 41,015,402 L210P probably damaging Het
Muc16 T C 9: 18,641,216 T4594A probably benign Het
Olfm5 A T 7: 104,159,980 C208S probably damaging Het
Olfr1355 T C 10: 78,879,577 V135A possibly damaging Het
Olfr1368 A T 13: 21,142,718 L113H probably damaging Het
Olfr1494 T A 19: 13,749,523 I139N possibly damaging Het
Parp12 T C 6: 39,111,736 I189V probably benign Het
Plin1 T C 7: 79,726,664 probably null Het
Prl7a1 C T 13: 27,642,419 probably null Het
Ptpn23 T C 9: 110,388,744 D711G probably benign Het
Rgs22 A T 15: 36,103,808 I169N probably damaging Het
Scn7a G T 2: 66,757,286 H24Q possibly damaging Het
Scrt2 C T 2: 152,093,086 P53L probably damaging Het
Sh3rf1 A T 8: 61,349,424 I264L probably benign Het
Smarcd1 A T 15: 99,709,325 D393V probably damaging Het
Spag17 T G 3: 100,101,435 N1960K probably benign Het
Ssb A G 2: 69,866,501 T62A possibly damaging Het
Taar7b T A 10: 24,000,062 Y42N possibly damaging Het
Terf1 A T 1: 15,813,139 I159L probably benign Het
Tff3 T G 17: 31,127,436 N54T probably benign Het
Top2a A G 11: 99,014,992 L285P probably benign Het
Trim24 A G 6: 37,919,457 Y283C probably damaging Het
Trim58 T C 11: 58,640,579 C38R probably damaging Het
Trpa1 T A 1: 14,890,424 T647S probably benign Het
Trpm4 A T 7: 45,310,709 probably null Het
Trpm6 C T 19: 18,854,033 Q1421* probably null Het
Ubr2 A T 17: 46,974,056 probably null Het
Vmn1r46 T G 6: 89,976,994 I275S possibly damaging Het
Vmn2r54 A G 7: 12,632,161 F282S possibly damaging Het
Vmn2r57 A G 7: 41,399,794 S844P possibly damaging Het
Vps13a A C 19: 16,710,879 C855G probably benign Het
Wdr31 T A 4: 62,463,429 Q55L probably benign Het
Other mutations in Cbs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01568:Cbs APN 17 31621514 missense possibly damaging 0.90
IGL02030:Cbs APN 17 31625489 critical splice donor site probably null
IGL02089:Cbs APN 17 31615545 missense probably benign 0.13
IGL02274:Cbs APN 17 31625948 unclassified probably null
IGL02733:Cbs APN 17 31625031 missense probably benign 0.01
PIT4418001:Cbs UTSW 17 31615521 missense possibly damaging 0.89
R0334:Cbs UTSW 17 31619156 missense probably damaging 1.00
R0398:Cbs UTSW 17 31617242 missense probably benign 0.01
R0466:Cbs UTSW 17 31616152 missense probably benign
R0732:Cbs UTSW 17 31625029 missense probably benign 0.00
R1125:Cbs UTSW 17 31632831 missense probably benign 0.00
R1586:Cbs UTSW 17 31622474 missense probably damaging 1.00
R1646:Cbs UTSW 17 31613195 missense probably benign 0.00
R1728:Cbs UTSW 17 31620949 missense probably benign 0.35
R1729:Cbs UTSW 17 31620949 missense probably benign 0.35
R1784:Cbs UTSW 17 31620949 missense probably benign 0.35
R1823:Cbs UTSW 17 31624271 missense probably damaging 1.00
R2200:Cbs UTSW 17 31624264 missense probably damaging 1.00
R3829:Cbs UTSW 17 31617381 splice site probably benign
R3892:Cbs UTSW 17 31616074 missense probably benign 0.06
R4073:Cbs UTSW 17 31633005 missense possibly damaging 0.80
R4089:Cbs UTSW 17 31633006 missense probably benign 0.03
R4799:Cbs UTSW 17 31632852 missense probably damaging 0.99
R5029:Cbs UTSW 17 31615482 missense possibly damaging 0.85
R5194:Cbs UTSW 17 31624224 splice site probably null
R5244:Cbs UTSW 17 31617160 missense probably damaging 1.00
R5660:Cbs UTSW 17 31624246 missense probably damaging 1.00
R5890:Cbs UTSW 17 31613219 missense probably damaging 0.97
R5935:Cbs UTSW 17 31632879 missense probably damaging 0.98
R5936:Cbs UTSW 17 31625094 missense probably damaging 0.98
R6891:Cbs UTSW 17 31622457 missense probably damaging 1.00
R7220:Cbs UTSW 17 31619217 missense probably benign 0.00
R7343:Cbs UTSW 17 31619139 missense possibly damaging 0.74
X0025:Cbs UTSW 17 31616137 missense possibly damaging 0.94
X0057:Cbs UTSW 17 31632970 missense probably benign 0.01
X0067:Cbs UTSW 17 31627555 missense probably damaging 1.00
Z1177:Cbs UTSW 17 31625882 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATGGAGCCATGCCAAGTGAAC -3'
(R):5'- TGACGAATGTATCTCTCATGGATC -3'

Sequencing Primer
(F):5'- TGAACACCAGCTTGGCTCAG -3'
(R):5'- CTCATGGATCTTTCTAGAGTATTGGC -3'
Posted On2019-05-15