Incidental Mutation 'R7127:Spen'
ID 552380
Institutional Source Beutler Lab
Gene Symbol Spen
Ensembl Gene ENSMUSG00000040761
Gene Name spen family transcription repressor
Synonyms Mint
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7127 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 141467890-141538597 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 141476108 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 1736 (S1736L)
Ref Sequence ENSEMBL: ENSMUSP00000101412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078886] [ENSMUST00000105786]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000078886
AA Change: S1713L

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000077925
Gene: ENSMUSG00000040761
AA Change: S1713L

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 617 632 N/A INTRINSIC
low complexity region 669 691 N/A INTRINSIC
low complexity region 695 720 N/A INTRINSIC
low complexity region 749 773 N/A INTRINSIC
coiled coil region 800 825 N/A INTRINSIC
low complexity region 830 841 N/A INTRINSIC
internal_repeat_2 844 954 6.27e-5 PROSPERO
coiled coil region 1494 1522 N/A INTRINSIC
low complexity region 1587 1627 N/A INTRINSIC
low complexity region 1635 1641 N/A INTRINSIC
low complexity region 1642 1671 N/A INTRINSIC
low complexity region 1747 1758 N/A INTRINSIC
low complexity region 1810 1823 N/A INTRINSIC
low complexity region 1888 1903 N/A INTRINSIC
low complexity region 1940 1955 N/A INTRINSIC
low complexity region 2003 2012 N/A INTRINSIC
internal_repeat_2 2015 2115 6.27e-5 PROSPERO
low complexity region 2127 2147 N/A INTRINSIC
low complexity region 2169 2191 N/A INTRINSIC
low complexity region 2207 2219 N/A INTRINSIC
low complexity region 2304 2323 N/A INTRINSIC
low complexity region 2332 2371 N/A INTRINSIC
low complexity region 2396 2413 N/A INTRINSIC
low complexity region 2518 2533 N/A INTRINSIC
low complexity region 2545 2555 N/A INTRINSIC
low complexity region 2696 2722 N/A INTRINSIC
low complexity region 2931 2942 N/A INTRINSIC
low complexity region 2994 3006 N/A INTRINSIC
low complexity region 3192 3212 N/A INTRINSIC
low complexity region 3299 3337 N/A INTRINSIC
Pfam:SPOC 3465 3586 2.7e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105786
AA Change: S1736L

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101412
Gene: ENSMUSG00000040761
AA Change: S1736L

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 692 714 N/A INTRINSIC
low complexity region 718 743 N/A INTRINSIC
low complexity region 772 796 N/A INTRINSIC
coiled coil region 823 848 N/A INTRINSIC
low complexity region 853 864 N/A INTRINSIC
internal_repeat_2 867 977 8.58e-5 PROSPERO
coiled coil region 1517 1545 N/A INTRINSIC
low complexity region 1610 1650 N/A INTRINSIC
low complexity region 1658 1664 N/A INTRINSIC
low complexity region 1665 1694 N/A INTRINSIC
low complexity region 1770 1781 N/A INTRINSIC
low complexity region 1833 1846 N/A INTRINSIC
low complexity region 1911 1926 N/A INTRINSIC
low complexity region 1963 1978 N/A INTRINSIC
low complexity region 2026 2035 N/A INTRINSIC
internal_repeat_2 2038 2138 8.58e-5 PROSPERO
low complexity region 2150 2170 N/A INTRINSIC
low complexity region 2192 2214 N/A INTRINSIC
low complexity region 2230 2242 N/A INTRINSIC
low complexity region 2327 2346 N/A INTRINSIC
low complexity region 2355 2394 N/A INTRINSIC
low complexity region 2419 2436 N/A INTRINSIC
low complexity region 2541 2556 N/A INTRINSIC
low complexity region 2568 2578 N/A INTRINSIC
low complexity region 2719 2745 N/A INTRINSIC
low complexity region 2954 2965 N/A INTRINSIC
low complexity region 3017 3029 N/A INTRINSIC
low complexity region 3215 3235 N/A INTRINSIC
low complexity region 3322 3360 N/A INTRINSIC
Pfam:SPOC 3488 3609 2.7e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a hormone inducible transcriptional repressor. Repression of transcription by this gene product can occur through interactions with other repressors, by the recruitment of proteins involved in histone deacetylation, or through sequestration of transcriptional activators. The product of this gene contains a carboxy-terminal domain that permits binding to other corepressor proteins. This domain also permits interaction with members of the NuRD complex, a nucleosome remodeling protein complex that contains deacetylase activity. In addition, this repressor contains several RNA recognition motifs that confer binding to a steroid receptor RNA coactivator; this binding can modulate the activity of both liganded and nonliganded steroid receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during late gestation exhibiting morphological abnormalities of the heart, pancreas, and liver. Inactivation of this gene also affects the differentiation of B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,327,945 F830L possibly damaging Het
Abca15 C T 7: 120,332,602 T26I probably benign Het
Adam5 A T 8: 24,810,781 I244N probably damaging Het
Adam7 A G 14: 68,514,769 probably null Het
Aox4 T A 1: 58,228,874 N204K probably benign Het
Arl13b C T 16: 62,801,739 G397D probably damaging Het
AU041133 T C 10: 82,150,866 F118L probably benign Het
Brinp1 C T 4: 68,793,023 R316H probably benign Het
Cabcoco1 C T 10: 68,436,330 V268I probably benign Het
Car15 T C 16: 17,838,196 probably benign Het
Ccdc185 G T 1: 182,748,856 D89E possibly damaging Het
Cckar T A 5: 53,706,475 Y48F probably damaging Het
Cdyl T A 13: 35,856,668 S282T probably benign Het
Clca1 T C 3: 145,006,045 T730A probably damaging Het
Cracr2b T C 7: 141,465,782 S318P possibly damaging Het
Depdc1b T C 13: 108,323,928 F24S probably damaging Het
Duox2 C T 2: 122,291,949 G565D probably benign Het
Ehbp1 A T 11: 22,053,529 Y1073* probably null Het
Epg5 A T 18: 78,028,925 N2384I probably damaging Het
Fam171b A G 2: 83,879,766 D594G probably benign Het
Flad1 A G 3: 89,403,418 Y441H probably damaging Het
Fn1 T C 1: 71,597,544 T2150A probably benign Het
Fnta C A 8: 26,007,203 R206L probably damaging Het
Gadd45b A T 10: 80,931,165 M95L probably benign Het
Gbp8 A T 5: 105,017,712 H358Q probably benign Het
Glipr1l3 C A 10: 112,148,090 G157V probably damaging Het
Hoxc13 T C 15: 102,921,468 I94T possibly damaging Het
Hunk A G 16: 90,475,891 D361G probably damaging Het
Igkv3-4 T A 6: 70,672,171 Y51* probably null Het
Kif26a C T 12: 112,178,145 P1611L probably damaging Het
Lamb1 T C 12: 31,324,315 L1559P probably damaging Het
Lrrc8d T C 5: 105,812,963 V413A probably damaging Het
Med6 C T 12: 81,589,000 R86Q probably damaging Het
Myrf A T 19: 10,215,341 S605T probably benign Het
Olfr792 T A 10: 129,541,067 C177S probably damaging Het
Plk3 A T 4: 117,130,570 V429E probably benign Het
Plrg1 C T 3: 83,059,915 P131L probably damaging Het
Plscr4 C T 9: 92,490,778 R318* probably null Het
Rab34 A T 11: 78,191,230 K152* probably null Het
Rasef A T 4: 73,744,132 S194T probably damaging Het
Rcc1 A G 4: 132,334,796 S269P probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Ryr2 C T 13: 11,655,713 V3466M probably damaging Het
Scin A G 12: 40,105,072 I174T possibly damaging Het
Serpinb8 A G 1: 107,597,470 M1V probably null Het
Smok3c A T 5: 138,064,709 I153F probably damaging Het
Sspo T A 6: 48,449,512 M155K probably benign Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Sun2 T C 15: 79,727,899 I528M probably benign Het
Syne1 G A 10: 5,243,180 A3956V probably damaging Het
Taok2 G T 7: 126,867,154 A831E possibly damaging Het
Tas2r126 T C 6: 42,434,805 F91L probably damaging Het
Tas2r140 A G 6: 133,054,959 S279P possibly damaging Het
Tiam1 A T 16: 89,860,260 L696H probably damaging Het
Trank1 T G 9: 111,365,796 S963A possibly damaging Het
Trf A G 9: 103,225,127 V184A probably benign Het
Ttll13 T A 7: 80,253,658 M231K possibly damaging Het
Tuba1a T G 15: 98,951,574 T41P probably benign Het
Zfhx4 A G 3: 5,413,044 Q3573R probably damaging Het
Zfp141 G A 7: 42,475,429 H540Y probably damaging Het
Other mutations in Spen
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Spen APN 4 141489901 missense unknown
IGL01357:Spen APN 4 141517113 missense unknown
IGL02184:Spen APN 4 141487606 missense unknown
IGL02226:Spen APN 4 141478146 missense unknown
IGL02321:Spen APN 4 141517130 missense unknown
IGL02350:Spen APN 4 141477579 missense unknown
IGL02357:Spen APN 4 141477579 missense unknown
IGL02627:Spen APN 4 141473015 missense probably damaging 0.99
IGL02683:Spen APN 4 141471645 missense probably benign 0.06
IGL02945:Spen APN 4 141494313 missense unknown
IGL02950:Spen APN 4 141469508 missense probably damaging 1.00
IGL03008:Spen APN 4 141476137 missense possibly damaging 0.70
IGL03019:Spen APN 4 141478916 missense unknown
IGL03038:Spen APN 4 141538239 missense unknown
IGL03334:Spen APN 4 141469969 missense probably damaging 1.00
filtered UTSW 4 141477372 missense unknown
mentholated UTSW 4 141469400 missense possibly damaging 0.78
R0105:Spen UTSW 4 141469810 splice site probably benign
R0268:Spen UTSW 4 141477557 missense unknown
R0359:Spen UTSW 4 141516870 missense unknown
R0394:Spen UTSW 4 141474203 missense probably benign 0.03
R0423:Spen UTSW 4 141479336 missense unknown
R0433:Spen UTSW 4 141483758 missense unknown
R0462:Spen UTSW 4 141473651 missense probably damaging 1.00
R0687:Spen UTSW 4 141488028 missense unknown
R0699:Spen UTSW 4 141474391 missense possibly damaging 0.72
R0865:Spen UTSW 4 141471870 missense probably benign 0.11
R0918:Spen UTSW 4 141485564 missense unknown
R1034:Spen UTSW 4 141475752 missense probably benign 0.33
R1341:Spen UTSW 4 141469400 missense possibly damaging 0.78
R1401:Spen UTSW 4 141471821 missense probably damaging 0.98
R1509:Spen UTSW 4 141475635 missense probably benign 0.00
R1509:Spen UTSW 4 141475700 missense possibly damaging 0.53
R1561:Spen UTSW 4 141472383 nonsense probably null
R1589:Spen UTSW 4 141488024 missense unknown
R1640:Spen UTSW 4 141468943 missense probably damaging 0.98
R1758:Spen UTSW 4 141476375 missense unknown
R1764:Spen UTSW 4 141472950 missense probably damaging 1.00
R1824:Spen UTSW 4 141472785 missense probably damaging 1.00
R1899:Spen UTSW 4 141470343 missense probably benign 0.17
R1916:Spen UTSW 4 141472598 missense probably damaging 1.00
R2011:Spen UTSW 4 141473329 missense probably damaging 1.00
R2295:Spen UTSW 4 141477273 missense unknown
R2379:Spen UTSW 4 141516927 missense unknown
R2404:Spen UTSW 4 141477905 missense unknown
R3719:Spen UTSW 4 141517183 missense unknown
R3889:Spen UTSW 4 141477881 missense unknown
R3945:Spen UTSW 4 141477353 missense unknown
R4227:Spen UTSW 4 141522147 missense unknown
R4326:Spen UTSW 4 141477372 missense unknown
R4382:Spen UTSW 4 141473139 missense possibly damaging 0.88
R4542:Spen UTSW 4 141476786 missense unknown
R4757:Spen UTSW 4 141473079 nonsense probably null
R4771:Spen UTSW 4 141472596 missense probably benign 0.14
R5072:Spen UTSW 4 141522302 missense unknown
R5121:Spen UTSW 4 141476099 missense probably benign 0.00
R5176:Spen UTSW 4 141476276 missense unknown
R5290:Spen UTSW 4 141473816 missense probably damaging 1.00
R5291:Spen UTSW 4 141488079 missense unknown
R5293:Spen UTSW 4 141472406 missense possibly damaging 0.89
R5347:Spen UTSW 4 141471485 missense probably benign 0.26
R5511:Spen UTSW 4 141475064 missense possibly damaging 0.86
R5511:Spen UTSW 4 141516838 missense unknown
R5772:Spen UTSW 4 141478184 missense unknown
R5834:Spen UTSW 4 141471843 missense possibly damaging 0.63
R5858:Spen UTSW 4 141473871 missense probably benign 0.05
R6214:Spen UTSW 4 141479112 missense unknown
R6232:Spen UTSW 4 141517022 missense unknown
R6345:Spen UTSW 4 141471633 missense possibly damaging 0.86
R6419:Spen UTSW 4 141476310 missense unknown
R6455:Spen UTSW 4 141475509 missense probably damaging 0.97
R6979:Spen UTSW 4 141478063 missense unknown
R6994:Spen UTSW 4 141493459 missense unknown
R7018:Spen UTSW 4 141493444 missense unknown
R7040:Spen UTSW 4 141494382 missense unknown
R7218:Spen UTSW 4 141472650 missense possibly damaging 0.54
R7234:Spen UTSW 4 141479135 missense unknown
R7316:Spen UTSW 4 141477054 missense unknown
R7350:Spen UTSW 4 141479385 missense unknown
R7356:Spen UTSW 4 141471924 nonsense probably null
R7400:Spen UTSW 4 141473741 missense probably damaging 1.00
R7470:Spen UTSW 4 141479294 missense unknown
R7698:Spen UTSW 4 141472845 missense probably damaging 1.00
R7858:Spen UTSW 4 141488131 splice site probably null
R8033:Spen UTSW 4 141471746 missense probably benign 0.03
R8064:Spen UTSW 4 141475700 missense possibly damaging 0.53
R8159:Spen UTSW 4 141475003 missense possibly damaging 0.53
R8187:Spen UTSW 4 141472905 missense possibly damaging 0.93
R8463:Spen UTSW 4 141522279 missense unknown
R8557:Spen UTSW 4 141470370 missense probably benign 0.14
R8558:Spen UTSW 4 141470370 missense probably benign 0.14
R8672:Spen UTSW 4 141470370 missense probably benign 0.14
R8673:Spen UTSW 4 141470370 missense probably benign 0.14
R8674:Spen UTSW 4 141470370 missense probably benign 0.14
R8714:Spen UTSW 4 141488003 missense unknown
R8735:Spen UTSW 4 141469818 missense probably benign 0.32
R8762:Spen UTSW 4 141472950 missense probably damaging 1.00
R8877:Spen UTSW 4 141471826 nonsense probably null
R8878:Spen UTSW 4 141477209 missense unknown
R8937:Spen UTSW 4 141474063 missense probably damaging 1.00
R8939:Spen UTSW 4 141475658 missense possibly damaging 0.72
R8968:Spen UTSW 4 141470390 missense probably benign 0.02
R8971:Spen UTSW 4 141474578 missense possibly damaging 0.53
R9016:Spen UTSW 4 141473627 missense probably damaging 1.00
R9072:Spen UTSW 4 141476391 missense unknown
R9073:Spen UTSW 4 141476391 missense unknown
R9120:Spen UTSW 4 141472922 missense
R9136:Spen UTSW 4 141522312 missense unknown
R9138:Spen UTSW 4 141469486 missense probably damaging 1.00
R9150:Spen UTSW 4 141517157 missense unknown
R9225:Spen UTSW 4 141475632 missense possibly damaging 0.53
R9492:Spen UTSW 4 141471787 missense probably benign 0.26
R9537:Spen UTSW 4 141471704 missense probably benign 0.15
R9537:Spen UTSW 4 141516845 small deletion probably benign
R9602:Spen UTSW 4 141477872 missense unknown
R9609:Spen UTSW 4 141488108 missense unknown
R9686:Spen UTSW 4 141472635 missense probably benign 0.27
R9697:Spen UTSW 4 141468964 missense probably damaging 1.00
R9713:Spen UTSW 4 141517020 missense unknown
T0722:Spen UTSW 4 141474353 missense probably benign 0.33
T0975:Spen UTSW 4 141474353 missense probably benign 0.33
Z1088:Spen UTSW 4 141477976 missense unknown
Z1088:Spen UTSW 4 141477977 missense unknown
Predicted Primers PCR Primer
(F):5'- AGCTTCTGATGCAACCCCAG -3'
(R):5'- AAAGCCCCTGTTTCAGCTGG -3'

Sequencing Primer
(F):5'- AACCCCAGCGTTCTGAGTG -3'
(R):5'- TCACCGTCGTGACACCAGAG -3'
Posted On 2019-05-15