Incidental Mutation 'R7127:Olfr792'
ID552406
Institutional Source Beutler Lab
Gene Symbol Olfr792
Ensembl Gene ENSMUSG00000094496
Gene Nameolfactory receptor 792
SynonymsGA_x6K02T2PULF-11219415-11220350, MOR108-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R7127 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location129539162-129542534 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129541067 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 177 (C177S)
Ref Sequence ENSEMBL: ENSMUSP00000149872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076575] [ENSMUST00000215436]
Predicted Effect probably damaging
Transcript: ENSMUST00000076575
AA Change: C177S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096707
Gene: ENSMUSG00000094496
AA Change: C177S

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 1.9e-53 PFAM
Pfam:7tm_1 39 288 4.7e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215436
AA Change: C177S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,327,945 F830L possibly damaging Het
Abca15 C T 7: 120,332,602 T26I probably benign Het
Adam5 A T 8: 24,810,781 I244N probably damaging Het
Adam7 A G 14: 68,514,769 probably null Het
Aox4 T A 1: 58,228,874 N204K probably benign Het
Arl13b C T 16: 62,801,739 G397D probably damaging Het
AU041133 T C 10: 82,150,866 F118L probably benign Het
Brinp1 C T 4: 68,793,023 R316H probably benign Het
Cabcoco1 C T 10: 68,436,330 V268I probably benign Het
Car15 T C 16: 17,838,196 probably benign Het
Ccdc185 G T 1: 182,748,856 D89E possibly damaging Het
Cckar T A 5: 53,706,475 Y48F probably damaging Het
Cdyl T A 13: 35,856,668 S282T probably benign Het
Clca1 T C 3: 145,006,045 T730A probably damaging Het
Cracr2b T C 7: 141,465,782 S318P possibly damaging Het
Depdc1b T C 13: 108,323,928 F24S probably damaging Het
Duox2 C T 2: 122,291,949 G565D probably benign Het
Ehbp1 A T 11: 22,053,529 Y1073* probably null Het
Epg5 A T 18: 78,028,925 N2384I probably damaging Het
Fam171b A G 2: 83,879,766 D594G probably benign Het
Flad1 A G 3: 89,403,418 Y441H probably damaging Het
Fn1 T C 1: 71,597,544 T2150A probably benign Het
Fnta C A 8: 26,007,203 R206L probably damaging Het
Gadd45b A T 10: 80,931,165 M95L probably benign Het
Gbp8 A T 5: 105,017,712 H358Q probably benign Het
Glipr1l3 C A 10: 112,148,090 G157V probably damaging Het
Hoxc13 T C 15: 102,921,468 I94T possibly damaging Het
Hunk A G 16: 90,475,891 D361G probably damaging Het
Igkv3-4 T A 6: 70,672,171 Y51* probably null Het
Kif26a C T 12: 112,178,145 P1611L probably damaging Het
Lamb1 T C 12: 31,324,315 L1559P probably damaging Het
Lrrc8d T C 5: 105,812,963 V413A probably damaging Het
Med6 C T 12: 81,589,000 R86Q probably damaging Het
Myrf A T 19: 10,215,341 S605T probably benign Het
Plk3 A T 4: 117,130,570 V429E probably benign Het
Plrg1 C T 3: 83,059,915 P131L probably damaging Het
Plscr4 C T 9: 92,490,778 R318* probably null Het
Rab34 A T 11: 78,191,230 K152* probably null Het
Rasef A T 4: 73,744,132 S194T probably damaging Het
Rcc1 A G 4: 132,334,796 S269P probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Ryr2 C T 13: 11,655,713 V3466M probably damaging Het
Scin A G 12: 40,105,072 I174T possibly damaging Het
Serpinb8 A G 1: 107,597,470 M1V probably null Het
Smok3c A T 5: 138,064,709 I153F probably damaging Het
Spen G A 4: 141,476,108 S1736L possibly damaging Het
Sspo T A 6: 48,449,512 M155K probably benign Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Sun2 T C 15: 79,727,899 I528M probably benign Het
Syne1 G A 10: 5,243,180 A3956V probably damaging Het
Taok2 G T 7: 126,867,154 A831E possibly damaging Het
Tas2r126 T C 6: 42,434,805 F91L probably damaging Het
Tas2r140 A G 6: 133,054,959 S279P possibly damaging Het
Tiam1 A T 16: 89,860,260 L696H probably damaging Het
Trank1 T G 9: 111,365,796 S963A possibly damaging Het
Trf A G 9: 103,225,127 V184A probably benign Het
Ttll13 T A 7: 80,253,658 M231K possibly damaging Het
Tuba1a T G 15: 98,951,574 T41P probably benign Het
Zfhx4 A G 3: 5,413,044 Q3573R probably damaging Het
Zfp141 G A 7: 42,475,429 H540Y probably damaging Het
Other mutations in Olfr792
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Olfr792 APN 10 129540842 missense probably benign 0.07
IGL01459:Olfr792 APN 10 129540541 start codon destroyed probably null 1.00
IGL02090:Olfr792 APN 10 129541307 missense probably damaging 1.00
IGL03338:Olfr792 APN 10 129541056 missense probably damaging 0.99
R0382:Olfr792 UTSW 10 129541014 missense probably benign 0.01
R1672:Olfr792 UTSW 10 129540692 missense probably benign 0.00
R2285:Olfr792 UTSW 10 129540668 missense probably benign 0.22
R2938:Olfr792 UTSW 10 129540615 missense probably damaging 1.00
R3498:Olfr792 UTSW 10 129540909 missense probably damaging 1.00
R5309:Olfr792 UTSW 10 129541265 missense probably benign 0.01
R5312:Olfr792 UTSW 10 129541265 missense probably benign 0.01
R6004:Olfr792 UTSW 10 129540890 missense probably benign 0.31
R6800:Olfr792 UTSW 10 129541263 missense probably damaging 1.00
R7167:Olfr792 UTSW 10 129540738 missense possibly damaging 0.88
R7763:Olfr792 UTSW 10 129541455 missense probably benign
R7819:Olfr792 UTSW 10 129540693 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGACCGCTATGTGGCTATCTG -3'
(R):5'- GTGTTGAGCACTGCTATACCC -3'

Sequencing Primer
(F):5'- ACCGCTATGTGGCTATCTGTAAGC -3'
(R):5'- GAGCACTGCTATACCCTTAGTCAAAG -3'
Posted On2019-05-15