Incidental Mutation 'R7128:Sp140'
ID 552430
Institutional Source Beutler Lab
Gene Symbol Sp140
Ensembl Gene ENSMUSG00000070031
Gene Name Sp140 nuclear body protein
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock # R7128 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 85600378-85645037 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 85620125 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 191 (D191V)
Ref Sequence ENSEMBL: ENSMUSP00000079095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080204]
AlphaFold Q6NSQ5
Predicted Effect possibly damaging
Transcript: ENSMUST00000080204
AA Change: D191V

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000079095
Gene: ENSMUSG00000070031
AA Change: D191V

DomainStartEndE-ValueType
Pfam:Sp100 24 121 5.1e-40 PFAM
low complexity region 213 223 N/A INTRINSIC
low complexity region 240 248 N/A INTRINSIC
SAND 256 329 4.17e-34 SMART
PHD 360 402 3.7e-8 SMART
BROMO 423 526 4.49e-10 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000123756
Gene: ENSMUSG00000070031
AA Change: D94V

DomainStartEndE-ValueType
low complexity region 117 127 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SP100 family of proteins, which are share common domains including an N-terminal homogeneously staining region domain followed by a SP100/autoimmune regulator/NucP41/P75/deformed epidermal autoregulatory factor domain, a plant homeobox zinc finger, and a bromodomain. The encoded protein is interferon-inducible and is expressed at high levels in the nuclei of leukocytes. Variants of this gene have been associated with multiple sclerosis, Crohn's disease, and chronic lymphocytic leukemia. Alternative splicing results in multiple variants. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,716,481 T1871A possibly damaging Het
Adgb T C 10: 10,472,241 D25G probably benign Het
Ak9 T C 10: 41,424,717 V1641A unknown Het
Akap2 T C 4: 57,855,816 S382P probably benign Het
Akirin2 T C 4: 34,562,435 I118T probably benign Het
Aldh1l1 G T 6: 90,563,379 Q215H probably benign Het
Arhgef26 T C 3: 62,419,550 F495L possibly damaging Het
Atg4a-ps T A 3: 103,645,747 R93* probably null Het
AW822073 T C 10: 58,223,657 Q425R unknown Het
Catsper3 A G 13: 55,798,849 I120V probably benign Het
Cavin2 A G 1: 51,289,420 Q12R possibly damaging Het
Cenpf A T 1: 189,684,991 F39Y probably damaging Het
Chfr T C 5: 110,143,636 Y107H probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Defb4 T A 8: 19,201,204 I29K possibly damaging Het
Dnah7c A G 1: 46,527,485 T619A probably benign Het
Emc3 A G 6: 113,517,920 L179P probably damaging Het
Eno3 G C 11: 70,658,604 V84L possibly damaging Het
Fam110a C T 2: 151,970,722 V43M probably damaging Het
Fam159a G T 4: 108,367,903 T154K probably benign Het
Fbxo30 T A 10: 11,290,116 L194* probably null Het
Galnt14 T C 17: 73,545,101 T108A probably benign Het
Glipr2 T C 4: 43,968,601 I51T probably benign Het
Gm1527 C T 3: 28,915,311 S270F possibly damaging Het
Gm3336 A G 8: 70,718,554 M1V probably null Het
Gm4744 T C 6: 40,950,376 D15G Het
Gm4763 C T 7: 24,725,999 probably null Het
Gm4924 G A 10: 82,378,699 C777Y unknown Het
Gm5901 G A 7: 105,378,201 G306S probably damaging Het
Gon4l T A 3: 88,895,692 N1203K possibly damaging Het
Gpr161 A T 1: 165,310,457 Y204F possibly damaging Het
Igsf10 T C 3: 59,328,905 E1285G probably benign Het
Irx6 T C 8: 92,677,366 L187P probably damaging Het
Itgb1bp1 A G 12: 21,272,088 Y117H probably benign Het
Itln1 C A 1: 171,530,575 D202Y possibly damaging Het
Kctd9 T C 14: 67,738,523 S242P probably benign Het
Lrrk2 A G 15: 91,801,885 H2143R probably benign Het
Lynx1 G A 15: 74,751,549 R50* probably null Het
Map10 A G 8: 125,671,853 I662V probably benign Het
Mlxipl T C 5: 135,133,851 L691P probably damaging Het
Muc16 A G 9: 18,643,004 S3998P unknown Het
Nalcn A T 14: 123,594,502 V120E probably damaging Het
Nfat5 T C 8: 107,358,691 S539P probably benign Het
Olfml3 T C 3: 103,737,168 M62V probably benign Het
Orm3 T C 4: 63,357,825 V158A probably benign Het
Pced1b A T 15: 97,384,598 K173* probably null Het
Pdzd7 T C 19: 45,027,949 D911G probably damaging Het
Pkn3 A G 2: 30,083,315 D383G probably damaging Het
Pm20d1 A G 1: 131,797,554 E46G probably benign Het
Pyroxd2 A T 19: 42,731,403 S455T probably benign Het
Rmnd5b T A 11: 51,624,537 I301F possibly damaging Het
Rnf225 A G 7: 12,927,984 N30S probably benign Het
Slfn3 T A 11: 83,214,895 C573S probably benign Het
Smc6 A G 12: 11,301,631 E887G probably damaging Het
Srf C T 17: 46,555,446 S128N possibly damaging Het
Sult6b1 T C 17: 78,894,641 D144G probably damaging Het
Syne1 G A 10: 5,243,180 A3956V probably damaging Het
Syt10 A T 15: 89,814,111 D343E probably damaging Het
Tgtp2 G A 11: 49,059,308 R146C possibly damaging Het
Tmcc3 A T 10: 94,430,634 probably benign Het
Tnfrsf1a A T 6: 125,361,536 T337S probably benign Het
Tns1 A T 1: 73,995,304 I144N Het
Trim11 A G 11: 58,978,277 E13G probably damaging Het
Trpm6 A T 19: 18,811,773 H569L possibly damaging Het
Ttbk2 T A 2: 120,746,088 I803L probably benign Het
Vmn1r21 G T 6: 57,843,951 N169K probably damaging Het
Vmn2r60 C T 7: 42,195,112 T633I probably damaging Het
Wt1 T C 2: 105,127,325 Y177H probably benign Het
Other mutations in Sp140
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Sp140 APN 1 85641822 nonsense probably null
IGL00561:Sp140 APN 1 85621672 missense probably benign 0.00
IGL00572:Sp140 APN 1 85621672 missense probably benign 0.00
IGL00591:Sp140 APN 1 85621672 missense probably benign 0.00
IGL00990:Sp140 APN 1 85626165 missense possibly damaging 0.59
IGL00990:Sp140 APN 1 85626133 missense probably benign 0.00
IGL02106:Sp140 APN 1 85643219 missense probably benign 0.01
IGL02303:Sp140 APN 1 85643009 nonsense probably null
PIT4131001:Sp140 UTSW 1 85601172 missense probably benign 0.03
PIT4131001:Sp140 UTSW 1 85610882 missense probably benign 0.03
PIT4131001:Sp140 UTSW 1 85643221 missense probably benign
PIT4142001:Sp140 UTSW 1 85601172 missense probably benign 0.03
PIT4142001:Sp140 UTSW 1 85610882 missense probably benign 0.03
PIT4142001:Sp140 UTSW 1 85643221 missense probably benign
R0378:Sp140 UTSW 1 85620051 splice site probably benign
R0815:Sp140 UTSW 1 85620051 splice site probably benign
R1320:Sp140 UTSW 1 85635608 critical splice donor site probably null
R1642:Sp140 UTSW 1 85610824 splice site probably null
R1791:Sp140 UTSW 1 85620051 splice site probably benign
R4776:Sp140 UTSW 1 85610828 missense possibly damaging 0.46
R4780:Sp140 UTSW 1 85610828 missense possibly damaging 0.46
R4839:Sp140 UTSW 1 85610808 unclassified probably benign
R5051:Sp140 UTSW 1 85610828 missense possibly damaging 0.46
R5287:Sp140 UTSW 1 85610824 splice site probably null
R5379:Sp140 UTSW 1 85610828 missense possibly damaging 0.46
R6518:Sp140 UTSW 1 85644570 critical splice acceptor site probably benign
R7125:Sp140 UTSW 1 85644569 critical splice acceptor site probably benign
R7785:Sp140 UTSW 1 85620098 missense probably benign 0.00
R8033:Sp140 UTSW 1 85620094 missense probably benign 0.01
R8481:Sp140 UTSW 1 85641791 missense probably damaging 0.99
R8501:Sp140 UTSW 1 85641740 missense probably damaging 1.00
R8830:Sp140 UTSW 1 85644574 critical splice acceptor site probably benign
R8994:Sp140 UTSW 1 85621882 splice site probably null
R9053:Sp140 UTSW 1 85644569 critical splice acceptor site probably benign
R9137:Sp140 UTSW 1 85642576 missense probably damaging 0.99
Z1191:Sp140 UTSW 1 85641803 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATTTACAGGAAGGTCATGTGTCAC -3'
(R):5'- TTTCTCCAGCTCCCAACAAG -3'

Sequencing Primer
(F):5'- CCTGGAAAATTAGGTGACACCCTG -3'
(R):5'- TTTCTCCAGCTCCCAACAAGAAAATG -3'
Posted On 2019-05-15